Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM triazole ligand Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amin (TBTA, Thermo Fisher Scientific, 454531000), 62.5 μM biotin-alkyne tag (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... pentaacetoxymethyl ester (Fluo-3/AM) (Molecular Probes, Eugene, OR, USA), which was observed with the laser-scanning confocal microscopy (LSCM ...
-
bioRxiv - Immunology 2022Quote: ... and 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM, Invitrogen), were used ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Neuroscience 2020Quote: ... freshly mitochondria isolated from pupae were resuspended in respiration buffer (0.5 mg/ml) containing Tetramethylrhodamine methyl ester perchlorate (0.5 μM) (Thermo Fisher). The excitation spectra were scanned from 520 nm to 580 nm using 590 nm emission wavelengths ...
-
bioRxiv - Biochemistry 2021Quote: ... The RBD/Legobody complex at 2.5mg/ml were incubated with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:25∼28 molar ratio for 2 hrs on ice ...
-
bioRxiv - Neuroscience 2022Quote: [Ca2+]c was measured by ratiometric analysis using acetoxy-methyl-ester Fura-2 (Fura-2/AM; F1221 Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: MEX-3 was fluorescently labeled with DyLight-488 NHS Ester (ThermoFisher) (Putnam and Seydoux ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescently tagged G-actin was prepared by covalent modification with Alexa Fluor™ 594 Carboxylic Acid (Thermo Fisher Scientific 15461054) (Alvarado and Koenderink ...
-
bioRxiv - Immunology 2023Quote: ... 5 mg of Alexa Fluor 488 NHS Ester dye (Invitrogen) was dissolved in 0.5 ml DMSO ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.4) containing 2 mM glucose for 2 hr with 100 nM of tetramethylrhodamine methyl ester (TMRM; Invitrogen, CA, USA). After the incubation ...
-
bioRxiv - Biochemistry 2021Quote: The KDELR/Legobody complex at 0.8mg/ml was PEGylated by incubation with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:40 molar ratio for 2 hrs on ice to reduce preferred particle orientation on the grids ...
-
bioRxiv - Microbiology 2023Quote: ... aeruginosa growth support by pyochelin and pyochelin methyl ester were performed in M9 minimal medium supplemented with 500 µM 2,2’-Bipyridine (Fisher Scientific). M9 minimal medium was prepared as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then pegylated for 15 minutes with 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) before grids.
-
bioRxiv - Biochemistry 2022Quote: Changes in the mitochondrial membrane potential were determined as the changes in tetramethylrhodamine methyl ester (TMRM, T668, Thermo Fisher Scientific) fluorescence according to the manufacturer’s instructions with few modifications ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Microbiology 2024Quote: ... Xanthine and 3-methyl xanthine were purchased from Acros Organics (Antwerpen, Belgium). 1-methyl xanthine and Paraxanthine were purchased from ChemScene (Monmouth Junction ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco, MA]/44 mM sodium bicarbonate [Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was then heated to 55 °C and held for 45 min before purification using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked for 1h at RT in 5% NBCS (Gibco, #16010-159), antibiotic-antimycotic (Gibco ...
-
bioRxiv - Biophysics 2020Quote: ... This initial PEG treatment was followed by a secondary PEG treatment with 25mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific). These treatments resulted in a biotin-coated surface on the slide ...
-
bioRxiv - Biophysics 2023Quote: ... then followed by a secondary PEG treatment with 25 mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific). A microfluidics chamber was constructed on the slide ...
-
bioRxiv - Biophysics 2024Quote: ... the slides were treated with a short-chain PEG solution (25 mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific) in 0.1 M sodium bicarbonate ...
-
bioRxiv - Cell Biology 2024Quote: The mitochondrial membrane potential was measured using tetramethylrhodamine methyl ester (TMRM) from the MitoProbe™ TMRM Assay Kit (Thermo Scientific™). Cells were harvested and incubated with TMRM at 37°C for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Microbiology 2024Quote: ... Methyl-esterified free fatty acids were analyzed using a ThermoFisher Exactive GC mass spectrometer (ThermoFisher), and ions were introduced by electron impact ionization (70 eV) ...
-
bioRxiv - Biophysics 2020Quote: ... The confocal parameters were calibrated daily by measuring the FCS decay of a 20 nM TAMRA (carboxylic acid of tetramethyl rhodamine) free dye solution (Molecular Probes, Inc.) with a known diffusion coefficient (D = 420 μm2s−1 ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: FluoZin-3 acetoxymethyl (AM) ester (excitation 494 nm, emission 516 nm) (Molecular Probes) was reconstituted in dimethylsulfoxide (DMSO ...
-
bioRxiv - Zoology 2020Quote: ... and then incubated with 3 μM AM ester Calcium Crimson TM dye (Invitrogen) for 30 min at 27°C ...
-
bioRxiv - Genetics 2023Quote: ... each coverslip was incubated in 3 μl fura-2 acetoxymethyl (AM) ester (Invitrogen) in 1X HBSS containing 5 mg/ml BSA (Sigma- Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... live staining of retinal landmarks was performed by incubating live zebrafish embryos in 100 nM solution of Bodipy TR methyl ester (Thermo Fisher Scientific) in E3 embryo rearing media for 1 h at room temperature following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked for 1h at RT in blocking solution (5% rabbit serum (10510, ThermoFisher) and 1% BSA (A4503 ...
-
bioRxiv - Cancer Biology 2024Quote: ... labeled with CFSE with 5 μM CFSE (carboxyfluorescein succinimidyl ester, Life Technologies) in PBS containing 0.1% BSA (Millipore Sigma ...
-
bioRxiv - Immunology 2022Quote: ... resuspended in pre-sort buffer containing 3-5 nM SYTOX Green Nucleic Acid Stain (Thermo Fisher Scientific), and incubated for 20 min at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...