Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and valproic acid (3 mM, Acros Organics). The DNA/FectoPro amount was scaled proportionally depending on the size of the transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... cryosectioned zebrafish larvae were washed 3x in wash buffer for 5 min and subsequently stained with Filipin solution for 60 min in a humidified dark chamber and co-stained with BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany). Staining solution was removed and slides were washed twice in wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were stained with CellTrace BODIPY TR methyl ester (1:200 in PDT [1 % DMSO, 0.1 % Triton X-100 in PBS], cat# C34556, Thermo Fisher Scientific, Waltham, MA) for 20 min at RT and/or DAPI (5 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: The mitochondrial membrane potential was measured using the tetramethylrhodamine methyl ester (TMRM, 50 nM, Life technology, T668) and Mitotracker Green (100nM, Thermo Fisher Scientific, M7514) fluorescent probes according to the manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was aspirated and the cell pellet was resuspended in 150 μL KCl buffer (for composition, see Ca2+ uptake protocol above) supplemented with 500 nM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher Scientific, I34361) and 0.005% digitonin (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’,7’- Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein, Acetomxymethyl Ester (BCECF-AM, 5 µM) from Invitrogen. All drugs were dissolved in water and added to the standard aCSF except BCECF-AM incubated in Pluronic® F-127 (0.02% ...
-
bioRxiv - Microbiology 2021Quote: ... 1,2-Bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM, Invitrogen), calcium Ionophore A23187 (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μg/mL ascorbic acid (Gibco), and 2.16 g/mL β-glycerolphosphate (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... in 5% acetic acid (Thermo Fisher) to ensure uniform loading ...
-
bioRxiv - Developmental Biology 2024Quote: ... NHS-ester(Succinimidyl Ester) with Alexa 555 (A20009, Invitrogen) was added to the collagen stock at 1:1000 the day before ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: ... bacteria were supplemented with 5 μl of AlexaFluorTM 555 NHS ester (Molecular Probes) at a concentration of 1 mg/ml and left to be stained for 7 min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5-(and-6)-carboxytetramethylrhodamine succinimidyl ester (TAMRA-SE) were purchased from Invitrogen™ (Paisley ...
-
bioRxiv - Neuroscience 2023Quote: All fly lines were maintained in mixed sex groups in bottles on JazzMix media or our own food made following the same recipe (brown sugar, corn meal, yeast, agar, benzoic acid, methyl paraben and propionic acid; Fisher Scientific, Whitby, ON, Canada) at 25°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Mature sensory neurons in 8-well μ-slide chambers were co-stained with 10 nM tetramethylrhodamine methyl ester (TMRM; Life Technologies, Grand Island, NY) and 100 nM MitoTracker Green FM (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Each well was then further passivated by adding 9 μL of a freshly prepared aqueous solution of methyl-PEG4-NHS-Ester (10 mg/mL, Thermo Fisher, Cat. No. 22341), followed by adding 1 μL of 1 M NaHCO3 (pH 8.5) ...
-
bioRxiv - Physiology 2024Quote: ... Upon full differentiation myotubes were incubated for 30 minutes with 250 nM tetramethyorhadamine methyl ester perchlorate (TMRM) (T668, Thermo Fisher Scientific, Waltham, MA, USA), Hoechst 34580 (1 mg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Biophysics 2024Quote: ... and both MAb1 and MAb11 were separately mixed with 5 μl of Alexa Fluor™ 647 NHS Ester or Alexa Fluor™ 568 NHS Ester (Thermo Fisher Scientific) in DMSO (10 mg/ml ...
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Synthetic Biology 2020Quote: ... affibody was incubated with 3-fold molar excess of Alexa 647 Succinimidyl Ester (Life Technologies) for 1 h at room temperature and desalted with Zeba Spin Desalting Column prior to labeling with Methyltetrazine.
-
Revisiting the role of Toxoplasma gondii ERK7 in the maintenance and stability of the apical complexbioRxiv - Microbiology 2021Quote: ... The NHS-Ester staining (Thermofisher, DyLight™ 488 NHS Ester) was used at 5μg/mL and incubated 1 hour in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Biophysics 2022Quote: ... succinimidyl ester (Invitrogen), as previously described [59] ...
-
bioRxiv - Cell Biology 2023Quote: ... succinimidyl ester (Invitrogen) was mixed with fibrinogen solution in a 7.5:1 molar ratio for 1 hour at room temperature and then filtered through a HiTrap desalting column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: Mitochondrial membrane potential of primary neurons was measured by fluorescent staining of Tetramethylrhodamine methyl ester (Image-iT™ TMRM Reagent, ThermoFisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... The mitochondrial membrane potential and dysfunctional mitochondria were measured by staining BM cells with Tetramethylrhodamine Methyl Ester (TMRM 500 nM, Thermo Fisher Scientific, Cat. No. T668), MitoTracker Green (100 nM ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM; Thermo Fisher Scientific, Waltham, MA, USA). Cells were washed with phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Stock solutions of calcein acetomethyl ester (CAM; 5 mg/ml) (Thermo Fisher Scientific, C3100MP), propidium iodide (PI ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 5 μM carboxyfluorescein succinimidyl ester (CFSE; Life Technologies; Cat # C34554). For Day 2 studies ...
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% (v/v) acetic acid) (ThermoFisher, A40000279) to visualize the proteins run on the paper ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% non-essential amino acids (Gibco). Cells were maintained at 37 °C in a 5% CO2 environment with saturated humidity.
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).