Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... with Alexa Fluor 680 NHS Ester (Invitrogen) as above ...
-
bioRxiv - Cell Biology 2023Quote: ... or Alexa-405 succinimidyl ester (Life Technologies) at a final concentration of 0.25 mM and 2.5 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proliferation via carboxyfluorescein succinimidyl ester (Thermo Fisher) dilution and cytokine production via LEGENDplex were assessed after 3 to 5 days.
-
bioRxiv - Cell Biology 2023Quote: ... pHrodo™ Red succinimidyl ester (ThermoFisher Scientific) was resuspended in DMSO and conjugated to the fixed pathogens according to the manufacturers instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... DL550-NHS ester (Thermo Scientific , Cat#: 62262) and DL633-NHS ester (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... using the Succinimidyl Ester form (ThermoFisher A30051), reacting with free amine groups on the protein surface ...
-
bioRxiv - Cancer Biology 2022Quote: ... AF680 succinimidyl ester (Thermo Fisher Scientific A20008) was dissolved in DMSO at 10 mg/mL and added to the protein solution to give a final concentration of 1 mg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Succinimidyl Ester (SNARF) (ThermoFisher catalog no. S22801) and analyzed by flow cytometry at time of labeling (D0) ...
-
bioRxiv - Immunology 2023Quote: ... acetyl ester (CM-H2DCFDA) (Invitrogen, Waltham, MA) at 10uM for 45 minutes prior to cell surface marker staining for flow cytometry.
-
bioRxiv - Biophysics 2023Quote: ... Alexa Fluor® 488 succinimidyl ester (ThermoFisher) was added in 10-fold molar excess in 100 μL at 50 μM of pm-GHSR-Cter ...
-
Lipid Driven Inter-leaflet Coupling of Plasma Membrane Order Regulates FcεRI Signaling in Mast CellsbioRxiv - Biophysics 2022Quote: ... Alexa Fluor 488 (AF488) NHS ester (Invitrogen) was used to fluorescently label monoclonal anti-DNP (2,4-dinitrophenyl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Alexa Fluor 700-succinimidyl ester (Invitrogen, A20010) was added to the media at 37°C for 5 minutes to label non-intact cells ...
-
bioRxiv - Biochemistry 2023Quote: ... using Alexa-488 succinimidyl ester (Life Technologies). To minimize effects from the fluorophore we used a labeling fraction of 10 % for both microfluidics and open chamber assays.
-
bioRxiv - Cancer Biology 2024Quote: ... DyLight550-NHS ester (Thermo Scientific, Cat#: 62262) and DyLight680-NHS ester (Thermo Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Acetoxymethyl Ester (BCECF,AM) (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Bioengineering 2024Quote: Dylight 680 NHS-ester (46419, Thermo Scientific) Nanohole array fabrication equipment (optional)
-
bioRxiv - Cell Biology 2024Quote: ... FITC NHS ester (#46410, Thermo Fisher Scientific), EZ-Link NHS-Biotin (#20217 ...
-
bioRxiv - Cell Biology 2024Quote: ... Alexa Fluor NHS-Ester 594 (ThermoFisher, A20004)] or membrane staining with Bodipy TR ceramide (ThermoFisher D7540 ...
-
bioRxiv - Synthetic Biology 2021Quote: Indole and its derivatives (Table S8) used in this work were purchased from ACROS organics™ and TCI America™ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a synthetic defined medium supplemented with 0.1% (w/v) 5-Fluoroorotic Acid (5-FOA) (Thermo Fisher Scientific) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... and stable integrants resistant to 1.5 g/L 5-fluoroorotic acid (5-FOA) (Fisher Scientific, Hampton, NH) were isolated ...
-
bioRxiv - Biophysics 2022Quote: ... Matthias Mack (Signoret et al., 2000)MC-5 was fluorescently labeled using DyLight 650 NHS ester coupling kit (Thermo Fisher) with a dye:protein coupling ratio of 1.57:1.
-
bioRxiv - Microbiology 2021Quote: ... target cells were labelled with 5 µM of carboxyfluorescein succinimidyl ester (CFSE) from a CFSE cell proliferation kit (Invitrogen, C34554) for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: Rhodamine tubulin was generated by labeling tubulin with X-rhodamine SE (5(and-6) carboxy-X-rhodamine succinimidyl ester) dye (ThermoFisher). Labeling stoichiometry was determined using a molar extinction coefficient of 115,000 M-1 cm-1 for tubulin and 78,000 M-1 cm-1 for X-rhodamine [58] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Conjugation of the dye to the polymer was achieved by adding 5 mg of the amine-reactive Pacific Blue succinimidyl ester (ThermoFisher) to a solution of 20 mg AD (Fina Biosolutions ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... with NaOH) and were loaded with 5 μM Ca2+ dye Fluo-4 acetomethyl ester (Fluo-4 AM) (Invitrogen Life Technologies) for 20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: Cells were resuspended in PBS and incubated at 4 °C for 5 mins with 8 µg ml−1 Alexa Fluor 555 NHS ester (Invitrogen). Cells were then washed in PBS.
-
bioRxiv - Biochemistry 2024Quote: NHE activity was measured fluorometrically using the intracellularly trapped pH-sensitive dye BCECF (2ʹ,7ʹ-bis-(Carboxyethyl)-5(6ʹ)-carboxyfluorescein Acetoxymethyl Ester) (#B1170; Invitrogen) with the NH4Cl prepulse technique as described previously (Simonin & Fuster ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The slides were immediately incubated with 0.5 mg/ml biotin 3-sulfo-N-hydroxysuccinimide ester (EZ-link NHS biotin, 20217, Thermo Fisher Scientific, USA) in 0.2 M borate-buffered solution pH 8.6 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... The chips were immediately incubated with 0.5 mg/ml biotin 3-sulfo-N-hydroxysuccinimide ester (EZ-link NHS biotin, 20217, Thermo Fisher Scientific, USA) in 0.2 M borate-buffered solution pH 8.6 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... Alexa Fluor® 594 NHS Ester (Succinimidyl Ester) and Alexa Fluor® 594 Hydrazide were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The following NHS-ester dyes were used in the present study: DylightTM 405 NHS-ester (Thermo Fisher Scientific, 46400), DylightTM 594 NHS-ester (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Genetics 2020Quote: ... and 400 µl of 5% aqueous formic acid (Optima grade, Fisher Scientific), vortexed for 30 seconds and centrifuged at 8000 x g for 2 min at 10° C ...