Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ToPro-3 (1:1000, Invitrogen) added to the third wash to stain nuclei ...
-
bioRxiv - Neuroscience 2023Quote: P29 mice were anesthetized with isoflurane (1–3%) and 50 nl of the retrograde tracer cholera toxin subunit B (5% wt./vol in PBS, ThermoFisher Scientific, Cat # C-34775) were injected at 10nl/sec into the left SLM (ML ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: RPTEC organoids were imaged every 2-3 days with a EVOS FL 2 Auto microscope (Thermo Fisher) with a 4x objective ...
-
bioRxiv - Molecular Biology 2021Quote: ... Thawed CM aliquots were mixed 1:1 with basal media (BM) consisting of 2% B-27 (Gibco 12587001), 10 mM Nicotinamide (Sigma-Aldrich N0636) ...
-
bioRxiv - Neuroscience 2024Quote: ... Wisteria floribunda lectin (1:1000, B-1355-2, Vector) was visualized using Streptavidin 568 (1:500, S11226, Invitrogen).
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% B-27-RA (Thermofisher, #12587010)) and doxycycline (dox ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% B-27 (ref. 17504044, ThermoFisher) and 1% PenStrep (ref ...
-
bioRxiv - Cell Biology 2022Quote: ... 2% B-27 (Invitrogen, Carlsbad, CA), 0.25% glutamax-1 (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 2% B-27 (Gibco), 2mM 100x GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% B-27 supplement (50×) (Gibco), penicillin (100 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 2% B-27 (Gibco) and 0.25% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2% B-27 supplement (GIBCO), 1% GlutaMax (GIBCO) ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 2% B-27 (Gibco) for 1-2 days at 4°C until the second litter was born ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% B-27 (Cat# 17504044, Thermofisher), 1% penicillin/streptomycin sulfate from 10,000 µg/ml stock ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 2% B-27 (Gibco) and 0.25% GlutaMAX (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... Hygromycin B (2 mg/mL; Invitrogen) was used to select for successfully transduced cells ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2% B-27 supplement (Invitrogen). Half of the medium was replaced every 2-3 days ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... containing 2% B-27 supplement (Gibco), 4.2 mM sodium bicarbonate (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27-RA (Thermofisher, #12587010)) and doxycycline (dox ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2% B-27 (Gibco), penicillin/streptomycin (100 U/mL and 100 μg/mL respectively) ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% B-27 (Invitrogen), 0.5 mM glutamine (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 2% B-27 (Gibco), 1.8% HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2% B-27 supplement (GIBCO), 1% GlutaMax (GIBCO) ...
-
bioRxiv - Neuroscience 2023Quote: ... with 2% B-27 supplement (Gibco), 1% GlutaMax (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% B-27-RA (Thermofisher, #12587010), Doxycycline for a final concentration of 1ug/mL) ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2% B-27 (Gibco), 1.8% HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% B-27 (Gibco) and 0.25% GlutaMAX (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% B-27 (Gibco) and 0.25% GlutaMAX (Gibco).
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% B-27 (Gibco) and 0.25% GlutaMAX (Gibco).
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 2% B-27 (Gibco), 1.8% HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2% B-27 (Invitrogen), 1 mM L-glutamine and 1% penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2% B-27 (Gibco) and 1% Insulin-Transferrin-Selenium (Gibco).
-
bioRxiv - Biophysics 2022Quote: ... containing 2% B-27 supplement (Gibco), 1% GlutaMAX (Gibco) ...