Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... stained with Ghost-510 and 2-(N-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 60 µM) (Thermo Fisher Scientific) (30 min at 37 C) ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)-Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: RNA was isolated from the aqueous phase of homogenized spleens mixed with 1-bromo-3-chloropropane and purified with the PureLink RNA kit (Invitrogen) separately ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2% B-27 (Gibco), 1.5% glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 2% B-27 (Gibco), 1% GlutaMAX (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... 2% B-27 (Thermofisher) 2 mM GlutaMAX® (Thermofisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 (ThermoFisher), 4.8 μg/mL 5-Fluoro-2’-deoxyuridine (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Neuroscience 2022Quote: BDA was visualized with fluorophore-conjugated streptavidin (Thermo Fisher Scientific, Table 2; 1:1,000 for 3 h). The reaction was enhanced using the biotinylated tyramine (BT)-glucose oxidase (GO ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: In vivo labeling of tumor-infiltrating T lymphocytes (TILs) with 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG, Life Technologies, catalog: N13195) was done by intravenous (retroorbital ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Genomics 2023Quote: ... coated dishes in N2 medium (high-glucose DMEM, 1% N-2, 2% B-27 and 1% penicillin/streptomycin, from Thermo Fisher Scientific) at a density of 2×105 cells/cm2 ...
-
bioRxiv - Biochemistry 2023Quote: ... N-methyl-N-(trimethylsilyl)-triAuoroacetamide (TMS) and ammonium acetate were purchased from Thermo Fisher Scientific (Waltham) ...
-
bioRxiv - Cell Biology 2024Quote: The EU/EdU co-labelling mix was prepared by combining 100µM BrdU (5-Bromo-2’-deoxyuridine, Invitrogen) and 500µM EU in Nematostella medium with 2% DMSO and 50mM MgCl2 ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Cell Biology 2022Quote: ... HCEnCs were rinsed in DPBS and passaged at a ratio of 1:2 or 1:3 with TrypLE (Thermo Fisher Scientific) for 10-15 min at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Metabolites were further derivatized by adding 18 μl of N-methyl-N-(trimethylsilyl) trifluoroacetamide with or without 1% TMCS (Thermo Fisher Scientific) and 20 μl ethyl acetate (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Immunology 2024Quote: The glucose uptake in ILC2 was measured using the glucose analog 2-(N-(7-Nitrobenz-2-oxa- 1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher Scientific, Catalog No. N13195) which was stored at -20°C at a stock concentration of 10 mM (5 mg lyophilised powder in 1.46 mL dimethyl sulfoxide (DMSO)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro-3 (1:1000, Invitrogen). Secondary antibodies used in this study were purchased from Invitrogen and include ...
-
bioRxiv - Neuroscience 2024Quote: ... media was changed to Astrocyte-induction media (DMEM/F12 with 2% FBS, 1% B-27, 1% NEAA, 1% GlutaMAX, and 1% Penicillin- streptomycin (all Gibco)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...