Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by transfer to a positively charged nylon membrane and then crosslinked with EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide) at 60°C for 1–2 hours and prehybridized with ULTRAhyb Ultrasensitive Hybridization Buffer (Invitrogen, cat # AM8670). The membrane was then hybridized with 50 pmol mL−1 Biotin-labeled Locked Nucleic Acid-modified DNA probes (designed and synthesized by Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... senescent CD4+ T cells were treated with BrdU (5-bromo-2′-deoxyuridine; 10µM; B23151-ThermoFisher) for 72 hours ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in GFD medium supplemented with 5 mM L-glucose and 1 mM 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Invitrogen). Finally ...
-
bioRxiv - Cell Biology 2024Quote: Cells were transfected and 24h later treated with 250µM or 500µM of glucose fluorescent analogue 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (#N13195, Thermofisher) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 PierceTM protease inhibitor mini tablet/2 L; Thermo Scientific), sonicated ...
-
bioRxiv - Physiology 2020Quote: ... The membrane was probed with primary antibodies for α-Tubulin (ThermoFisher 322588, clone B-5-1-2), acetylated (Sigma T7451 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-desmocollin 2 and 3 (clone 7G6, Thermofisher), 1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSS117872 (Epsin-2) and HSS147867 (Epsin-3) (Invitrogen) on day 2 and 3 (Boucrot et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Passaged every 2-3 days with TrypleE (Gibco).
-
bioRxiv - Systems Biology 2021Quote: ... A total of 90 μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Lafayette, CO, U.S.A.) was then added to the samples and shaken at 1400 rpm for 30 min at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... and extracted total RNA using BCP (1-bromo-3-chloropropane; Life Technologies, Thermo Fisher Scientific, Inc., Waltham, MA, USA) with isopropanol precipitation ...
-
bioRxiv - Neuroscience 2024Quote: ... The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Immunology 2021Quote: ... Glucose uptake was measured by the uptake of glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG, Life Technologies). Cell surface and intracellular cytokine stainings of splenocytes and blood lymphocytes were performed as described (42) ...
-
bioRxiv - Physiology 2020Quote: ... 1 mM fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Life Technologies) was diluted in Live Cell Imaging Solution (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Cellular glucose uptake was measured by culturing cells in glucose free DMEM for 2 hours before adding 100µM of the fluorescent glucose analogue 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher, N13195). The analogue was incubated with MCF7s for 30 minutes and MSCs for 60 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 2 weeks of selection with 3 μg mL−1 of puromycin (Thermo Fisher Scientific). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... B -3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... and stained with 2-(4amidinophenyl)-1H-indole-6-carboxamidine (DAPI, 1 μg/mL; Invitrogen, D1306) and washed with Dulbecco’s PBS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 Pierce™ protease inhibitor mini tablet/2 L; Thermo Scientific). The lysate was sonicated then incubated with 500 units/1 L culture Benzonase Nuclease (Sigma-Aldrich ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Cell Biology 2021Quote: ... the media was replaced entirely with fresh retinal differentiation media (RDM) (DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX)) ...
-
bioRxiv - Cell Biology 2020Quote: ... the media was changed to retinal differentiation medium (RDM;DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Buffy coat was mixed 1:2 with PBS and added onto a Ficoll gradient in a 3:1 ratio (Invitrogen). This was centrifuged at 2100 rpm for 25 minutes at RT (w/o brakes) ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Immunology 2020Quote: Macrophages were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...