Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... A 1 ml aliquot was treated with 2 μM tetramethylrhodamine methyl ester perchlorate (TMRE) (Molecular Probes, USA) and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were applied for 2 hours in PBS/3% milk powder containing 1 μg/ml Hoechst-33342 (Invitrogen) or DAPI (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Activated/Cleaved Caspase-3 (1:1000; Cell Signalling Biology, CAT#: 9661S and Thermo Fisher Scientific, CAT#: 66470-2-IG), Nestin (1:1000 ...
-
bioRxiv - Genomics 2023Quote: ... and 100 μg/ml cycloheximide using Beckman Coulter UC tubes 9/16 x 3-1/2 (Fisher Scientific, NC9194790), and equilibrating overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 2 µL streptavidin-HRP (1:5,000; S911, Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... cells were fed daily with NPC maturation medium (1:1 mixture of DMEM/F12 Glutamax and Neurobasal-A supplemented with 1% N-2 and 2% B-27 minus vitamin A (Gibco). On day 20 ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were incubated with an alpha tubulin monoclonal antibody conjugated to Alexa Fluor 488 (B-5-1-2, Invitrogen, Carlsbad, CA) at 2 μg/mL in 1% BSA in PBS for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2024Quote: ... Medium was changed every 2-3 days and cells were passaged every 3-4 days using Versene (ThermoFisher) and medium supplemented with Y-27623 ROCK inhibitor (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Neuroscience 2024Quote: ... BODIPYTM-C12 500/510-C1 (4,4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid; Invitrogen) or BODIPYTM-C12 558/568 (4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid ...
-
bioRxiv - Biochemistry 2020Quote: ... Following 2 weeks of selection in 250 μg ml−1 Hygromycin B (Thermo Fisher) and 4 μg ml−1 Blasticidin (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Genetics 2020Quote: ... in a proportion of 4:3:2 using Lipofectamine 2000 (ThermoFisher). HEK293T cells were maintained in DMEM complete medium (DMEM [Gibco] supplemented with 10% of FBS and 100 UI of Penicillin/Streptomycin) ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 and 3 using the EVOS XL core microscope (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Biophysics 2024Quote: ... We passaged cells every 2–3 days using Accutase (Thermo Fisher).
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Microbiology 2024Quote: ... Xanthine and 3-methyl xanthine were purchased from Acros Organics (Antwerpen, Belgium). 1-methyl xanthine and Paraxanthine were purchased from ChemScene (Monmouth Junction ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...