Labshake search
Citations for Thermo Fisher :
3651 - 3700 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... biotin anti-human IgA Fab (Invitrogen A24462) was added at a dilution of 1:100,000 for 2 hours at 4 C to detect human IgA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-human CD20 APC-H7 and mouse anti-human CD73 PE were from e-Bioscience (Thermo Fisher Scientific). Monoclonal mouse anti-human Ki67 was from Dako Agilent Technologies (Les Ulis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time quantitative PCR assays were performed using TaqMan Gene Expression Master Mix and the probes human NEMO/IKBKG (Hs00415849_m1) and human GAPDH (Hs03929097_g1) (ThermoFisher Scientific). Amplifications were run in a Bio-Rad CFX96 real-time PCR system ...
-
bioRxiv - Biochemistry 2020Quote: ... The second incubation were performed with secondary antibody (Anti-Human IgG-Cy3, Jackson ImmunoReserarch; Anti-Human IgM-Cy5, Invitrogen) diluted in ratio 1:1000 in incubation buffer with 1% BSA ...
-
bioRxiv - Immunology 2020Quote: ... PE-Cy7-conjugated anti-human CD196 (CCR6) and PE-Cy7-conjugated anti-human MAVS mAbs were purchased from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2022Quote: ... Human AFP secreted into the sera of animals were determined by the Human AFP Elisa Quantification Kit (Invitrogen, EHAFP) following manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... In the analysis of the Woroniecka Human Diabetic Kidney Disease dataset (2011, Affymetrix Human Genome U133A 2.0 Array platform) 33 and the European renal cDNA bank (ERCB ...
-
bioRxiv - Biophysics 2023Quote: N-terminally 6xHis-tagged human Gβ1 (S2-N340) and human Gγ2 (M1-C68) were synthesized and separately cloned into pFastBac1 (Thermo Fisher) and expressed as described above ...
-
bioRxiv - Cell Biology 2023Quote: Human ApoE protein was quantified using the Invitrogen Human ApoE ELISA following the manufacturers guidelines (Invitrogen. Cat no. EHAPOE).
-
bioRxiv - Cancer Biology 2023Quote: ... Normal human melanocytes were grown in Melanocyte Growth Media 254 supplemented with Human Melanocyte Growth Supplement-2 (Life Technologies), calcium chloride (0.3 μM) ...
-
bioRxiv - Immunology 2023Quote: ... they were incubated for 10 min at room temperature with a combined Fc block solution (2μL Human Fc block [BD Biosciences, San Jose, CA, USA] + 3μL heat-inactivated human AB serum [Fisher Scientific, Waltham ...
-
bioRxiv - Immunology 2024Quote: ... corresponding to the concentration of the highest standard of recombinant human IFNγ (Human IFNγ Gamma Uncoated ELISA kit, Invitrogen). IFNγ concentrations below the level of detection by the ELISA standard curve were set to 0 pg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ELISAs for human Aβ40 and human Aβ42 were carried out using commercial kits (Aβ40: Invitrogen KHB3481; Aβ42: Invitrogen KHB3441) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF of red fluorescent protein gene (RFP)-fused Antp was inserted into a pIZ/V5-His vector (Invitrogen) driven by the OpIE2 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the C-terminal foldon trimerization motif followed by an 8×His-tag was cloned into the pcDNA3.1(+) expression vector (Invitrogen). Furthermore ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... extended with a nucleic acid sequence encoding for 6 histidine residues (His-tag) and cloned into the mammalian expression vector pcDNA3.1(+) (Invitrogen). The soluble antigen was produced by transient gene expression in CHO cells as described previously [38] and purified from the cell culture medium by Ni-NTA resin (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder, Applied Biosystems, in 10 μL of Hi-Di formamide ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder [Applied Biosystems] in 10 μL of Hi-Di formamide [Applied Biosystems] ...
-
bioRxiv - Biochemistry 2020Quote: ... Binding of the full-length S protein was detected by mouse anti-His IgG (Invitrogen MA121315, 2 μg/ml) and Alexa Fluor-488-labelled goat anti-mouse IgG (Invitrogen A11001 ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified PCR products were digested with XhoI and NheI and inserted into the pcDNA6/V5-His expression vector (Invitrogen) generating plasmid pMBA40 for POMGNT1 complementation ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA libraries were pooled for emulsion PCR using an Ion PI Hi-Q Chef Kit (Thermo Fisher Scientific). The enriched samples were loaded onto an Ion PI chip v3 with Ion Chef ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing was performed on the Ion Torrent PGM with the Ion PGM Hi-Q View Sequencing kit (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA-Seq templates were prepared using the Ion PGM Hi-Q View OT2 Kit (Thermo Fisher Scientific Inc.) on an Ion OneTouch 2 system ...
-
bioRxiv - Immunology 2022Quote: ... two alpacas were five times immunized with 200 µg His-NLRP1PYD using Imject™ Alum Adjuvant (Thermo Fisher Scientific) according to locally authorized protocols ...
-
bioRxiv - Immunology 2022Quote: ... The plate was coated with 2 µg/mL mouse anti-His antibody (Invitrogen cat. #MA1-21315-1MG, ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Cell Biology 2021Quote: ... reaction mixes were prepared using 2.5 μg recombinant His-ACBD5 with or without the addition of 0.3 mM ice-cold ATP (Thermo Fisher) and 0.1 ug GST-GSK3β (Abcam) ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Biophysics 2021Quote: Detergent extracted His-MBP-tagged proteins were applied to a 40 mL POROS MC 20 Ni2+ column (Applied Biosystems) equilibrated with buffer A (200 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... SmBChE1 and SmAChE3 (fSmChEs) were EcoRI/XbaI cloned into the C-terminal 6-His-tagged pPICZαA expression vector (Invitrogen) to facilitate secretory expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Systems Biology 2023Quote: ... and utilized Alt-R CRISPR-Cas9 crRNA/trRNA/Hi-Fi Cas9 ribonucleotide-protein complex (IDT) and Neon electroporation (ThermoFisher) to deliver the complex to the iPSC ...
-
bioRxiv - Plant Biology 2023Quote: ... and proteins were visualized using Ponceau stain as well as Western blot with monoclonal anti-His (Invitrogen MA1-21315), and polyclonal anti-GST (Thermo Scientific ...