Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Anti FLAG M5 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... for FLAG® (DYKDDDDK)-tagged proteins in iBind Western System (Invitrogen). Each tagged protein was visualized by 1-Step Ultra TMB-Blotting Solution (ThermoFisher Scientific).
-
bioRxiv - Biochemistry 2022Quote: ... and the upper half using 1:1000 diluted α-FLAG (ThermoFisher) to detect FANCD2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... contained 40 µM human Flag-tagged ubiquitin (Fisher Scientific U-120), 0.5 µM human His6-tagged Ubiquitin E1 enzyme (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... and FLAG-CUL4B and mutants in pcDNA5/FRT/TO vector (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... and blotted for FLAG on a 10% Bis-Tris gel (ThermoFisher) (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... they were transfected with Flag-Parkin using lipofectamine 2000 (Invitrogen, 11668019). 24 hours later ...
-
bioRxiv - Immunology 2023Quote: ... or Supersignal West Femto substrate (FLAG blots) (Thermo Fisher Scientific #34095) for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... FLAG and Strep-antibodies were purchased from Thermo Scientific (2-2.2.14), Sigma-Aldrich (F-1804 ...
-
bioRxiv - Microbiology 2023Quote: ... The FLAG-pTBK1-HA plasmid was generated by Gateway cloning (Invitrogen), using the FLAG-pTBK1 as template for generation of the entry clone (forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... FLAG-HA-SIVdeb Vpr was initially synthesised by GeneArt (Thermo Fisher) and cloned into our pLRGatewayIRESeYFP plasmid [46] using BamHI (into a BglII site ...
-
bioRxiv - Immunology 2022Quote: ... PTBPs anti-bodies were conjugated to different fluorophores with anti-body labeling kits from ThermoFisher (AF488 ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-tagged BNIP3 was cloned into a pcDNA3.1 vector (Thermo Fisher Scientific) or a pCDH vector (System Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... mKate2 or Strep-FLAG tags using the Gateway cloning system (Life Technologies). The expression of each transgene was controlled using the yeast upstream activation sequence promoter (UASp ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.1% Tween 20) and incubated with monoclonal FLAG tag antibody (ThermoFisher Scientific). Commercial goat anti-rabbit IgG antibody (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was extracted and immunoprecipitated with gp130-Flag (cat # 125623, Thermo Scientific). Western blots were then performed for detection of OSMR (cat # ab85575 ...
-
bioRxiv - Microbiology 2020Quote: ... and ACE2-FLAG were synthesized and cloned into pcDNA3.4 vector (Thermo Fisher). Recombinant proteins were prepared by Expi293 Expression System (Thermo Fisher ...
-
bioRxiv - Immunology 2019Quote: ... Viperin-flag consists of the pFLAG-CMV™ Gateway® backbone (Invitrogen), where a CMV promoter drives expression of the viperin with a flag tag at the N-terminus ...
-
bioRxiv - Genomics 2022Quote: ... The final overexpression construct for FLAG-NLS-M.CviPI-LaminB1 in pInducer20 (Invitrogen) was obtained through a recombination reaction using Gateway cloning (LR Clonase™ II ...
-
bioRxiv - Cancer Biology 2022Quote: ... Flag-Cdt2 (2 μg)) with turbofect™ (Thermo Fisher Scientific, Massachusetts, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and FLAG-PFKL-N702T were cloned into a pLenti6.3 vector (ThermoFisher Scientific). The presence of the mutations and the integrity of the constructs were verified by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... the AbC anti-rat/hamster compensation bead kit (Life Technologies) was used ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... FLAG-Con1mut-SPOP were subcloned into pcDNA™4/TO (Thermo Fisher Scientific) as described previously12 ...
-
bioRxiv - Biochemistry 2020Quote: ... a DNA fragment containing NcoI-Flag-Strep-Strep-NterminusPscN-NotI synthesized by Invitrogen, was cloned into the NcoI/NotI sites of pIApG-Strep-PscN ...
-
bioRxiv - Cell Biology 2021Quote: ... 3×FLAG-SHIP164Δ901-1099 constructs were transfected into Expi293F cells (Thermo Fisher Scientific) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020; α-HA: Invitrogen, #26183-HRP ...
-
bioRxiv - Microbiology 2020Quote: ... Flag and HA were detected with mouse monoclonal antibodies (Invitrogen, Carlsbad, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Flag pcDNA3/ERα/ERβ plasmids using Lipofectamine 3000 (Thermo Fisher Scientific) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The protein was eluted using 2mL 1.25mg/mL 3X Flag Peptide from Thermofisher in lysis buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... or a Flag-control plasmid using Lipofectamine® 2000 Transfection Reagent (ThermoFisher SCIENTIFIC) and cultured for 48h ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the recombination with pCAGEN-Flag-DEST using Gateway LR Clonase (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... R1-AD1-FLAG/HA-H3F3A cells were electroporated using Neon Transfection system (Invitrogen). After 3-5 days cells were trypsinized ...
-
bioRxiv - Biochemistry 2023Quote: ... The FLAG-tag monoclonal antibody conjugated to DyLight 800 4X PEG (ThermoFisher Scientific) was diluted to a final working concentration of 1:1000 in 1% nonfat milk in TBS/T ...
-
bioRxiv - Cell Biology 2023Quote: ... or S1S2 constructs tagged with FLAG epitope were transfected using Lipofectamine 3000 (Invitrogen) as described previously [11].
-
bioRxiv - Biochemistry 2023Quote: The genes of FLAG-AGO2 and -AGO3 were cloned into pFastBac-HTB (Invitrogen). Their recombinant proteins were overproduced in and purified from insect cells as previously reported and stored in Buffer E (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... with Flag-tagged siRNA resistant TDP-43 or pRc/CMV control vector (Invitrogen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Bound proteins were eluted by addition of 500ug/mL FLAG peptide (Thermo Fisher) in 50uL of RIPA+1% TritonX-100.The eluate fraction was combined with equal volume of 2X Laemelli amended with 5% β-mercaptoethanol.
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 μl of APC-conjugated anti-c-KIT (Invitrogen, CD11705) antibodies for 20 minutes at room temperature with rotation at 10 revolutions per minutes (rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... HCT116 cells were transfected with pCDNA-N-FLAG-SUPT5H-variants using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... F=Flag (https://emb.carnegiescience.edu/drosophila-gateway-vector-collection) using the Gateway cloning system (Invitrogen). AWG-MCS plasmids were used as GFP control for IP experiments.
-
bioRxiv - Biophysics 2019Quote: ... FLAG-tagged hZP3 and HA-tagged hZP4 were synthesized (GenScript; GeneArt/Thermo Fisher Scientific) and subcloned into pHLsec329 ...
-
bioRxiv - Microbiology 2021Quote: HEK293T cells (0.3 X106) were transfected with pCMV-FLAG-FBXO22 using Turbofect (Thermo Fisher) in 6-well plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... or pcDNA3-Flag-SPF45/ΔG/siR using lipofectamine 2000 reagent (Invitrogen–Thermo Fisher Scientific). At 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... or pcDNA3-Flag-SPF45/ΔG/siR using lipofectamine 2000 reagent (Invitrogen–Thermo Fisher Scientific). At 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLAG-tagged RNF219 and CNOT1 cDNAs were cloned into pCDNA5/FRT-TO vector (Invitrogen). The expression vectors were then transfected into HEK-293 Flp-In-TRex cells and followed by selection with hygromycin to generate stable cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... with an N-terminal FLAG- or HA-tag (16) or into pcDNA4/TO (Invitrogen) with an N-terminal FLAG- or EGFP-tag (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... Myc-SUMO (0.5 μg) and Flag-UBC9 (0.5 μg) by using Lipofectamin plus (Invitrogen). After incubation for 24 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... α-FLAG antibody were digested into Fab in a Zeba Desalt Spin Column (ThermoFisher) containing immobilized Ficin undergoing gentle rotation for 3-5 hours at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and RAW 264.7 EROS FLAG-tagged cells were maintained in DMEM medium (21969035, ThermoFisher) containing 10 % FBS (F7524 ...
-
bioRxiv - Immunology 2022Quote: ... was used to generate Flag-tagged Prom1 clones and deletion mutants in pcDNA3.1+ (Invitrogen). The primers used for cloning are listed in Supplementary Table 1.
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tag primer is GATTACAAGGATGACGACGATAAG) for 36 hours in Opti-MEM (31985062, Thermo Fisher) medium with 10 µL GeneTran III reagent (GT2211 ...