Labshake search
Citations for Thermo Fisher :
3351 - 3400 of 10000+ citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... experimental substrates were 1% agarose and contained 75mM sucrose, 1% ethanol and increasing concentrations (1.5%, 2.5%, and 3.5%) of acetic acid (ThermoFisher #A465-250); control substrates were 1% agarose and contained 75mM sucrose and 1% ethanol.
-
bioRxiv - Biophysics 2021Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Immunology 2021Quote: ... sodium pyruvate (1 mM), nonessential amino acids (0.1 mM), HEPES buffer (15 mM, pH 7.2-7.5) (all from Invitrogen, Life Technologies) and 2-mercaptoethanol (50 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
An Azobenzene G-quadruplex Ligand Exhibits Promising Antibacterial Activity against Escherichia colibioRxiv - Microbiology 2022Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Cell Biology 2022Quote: ... peptides in 1 % (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5 % (vol/vol ...
-
Multiomic Approach Characterises the Neuroprotective Role of Retromer in Regulating Lysosomal HealthbioRxiv - Neuroscience 2022Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
Spray-induced gene silencing (SIGS) as a tool for the management of Pine Pitch Canker forest diseasebioRxiv - Plant Biology 2024Quote: ... containing 0.4 µL of 1:1000 SYBR™ Green I Nucleic Acid Gel Stain (Thermo Fisher, Waltham, MA, USA). Primers FcRPB2-q-F and FcRPB2-q-R were used to amplify the F ...
-
bioRxiv - Cell Biology 2024Quote: ... Gels were rinsed in 1X TBE and immersed in SYBR Gold nucleic acid gel stain (1:10,000) (Invitrogen/ThermoFisher) for 30 min prior to fluorescent imaging on an ImageQuant LAS 4000 gel imaging system (GE) ...
-
bioRxiv - Cell Biology 2024Quote: ... Gels were rinsed in 1X TBE and immersed in SYBR Gold nucleic acid gel stain (1:10,000) (Invitrogen/ThermoFisher) for 30 min prior to fluorescent imaging on an ImageQuant LAS 4000 gel imaging system (GE) ...
-
bioRxiv - Microbiology 2024Quote: ... 1-in orbital diameter) or on solid agar (1.5% w/v) in either semi-defined Casamino Acid (Fisher Scientific) Hv-Cab medium23 supplemented with uracil (50 µg mL-1 final concentration ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 10% FBS and supplemented with 1:100 Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA, Gibco, 1114050), 1:100 Sodium Pyruvate (Gibco ...
-
bioRxiv - Systems Biology 2023Quote: ... Gels were run at 200 V for approximately 1 h and incubated with SYBR Gold nucleic acid stain (Invitrogen), diluted 1:10,000 in TBE buffer (90 mM Tris ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted twice from lysates using Phenol/Chloroform/Isoamyl Alcohol 25:24:1 (ThermoFisher Scientific Cat#10308293) treatment followed by centrifugation at 8,000 g for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Developmental Biology 2023Quote: hiPSCs in alginate hydrogels were incubated with SYTOX Green Nucleic Acid Stain (1 μM; Invitrogen, Thermo Fisher Scientific S7020) for 1 hr at 37°C and imaged on a Leica SP8 laser scanning confocal microscope with a HC FLUOTAR L 25×/0.95 NA water immersion objective.
-
bioRxiv - Developmental Biology 2023Quote: hiPSCs in alginate hydrogels were incubated with SYTOX Green Nucleic Acid Stain (1 μM; Invitrogen, Thermo Fisher Scientific S7020) for 1 hr at 37°C and imaged on a Leica SP8 laser scanning confocal microscope with a HC FLUOTAR L 25×/0.95 NA water immersion objective.
-
bioRxiv - Microbiology 2023Quote: ... After staining the gel for 10 min in 1x TBE buffer with a 1:10,000 dilution of SYBR Gold Nucleic Acid Gel Stain (Invitrogen), the bands in the range of 130- 1000 bp were cut into small pieces and transfer to a 2 ml LoBind tube ...
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile in 0.1% (v/v) formic acid (250 nl min−1) formed by a Dionex UltiMate 3000 series HPLC (ThermoFisher) over 120 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected into an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the MELAS cells were grown in DMEM with 1 mM pyruvate supplemented with non-essential amino acids (Gibco), 50 μg/ml uridine ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... selenous acid (5 ng mL-1)]) and penicillin-streptomycin (1v/v%, Gibco™ Ref 15140122, Grand Island, NY, USA). Subcultivation of monolayers was performed at 70–80% confluence by detachment using TrypLE (Gibco™ Ref 12604013 ...
-
bioRxiv - Microbiology 2024Quote: ... 50 microliters of the oyster homogenate was pipetted onto CPM-24 plates (0.05% Difco Casamino Acids, 0.05% Difco Peptone, 1% Fisher Scientific purified agar ...
-
bioRxiv - Bioengineering 2024Quote: Protein concentrations of MsNAC and DF-1 cells were compared via a Bicinchoninic Acid Kit (BCA) (A55864, Thermo Scientific). MsNAC and DF-1 cell samples were centrifuged at 600xg for 5 minutes to isolate the cell pellet ...
-
bioRxiv - Immunology 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Cell Biology 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Cell Biology 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... peptides in 1% (vol/vol) formic acid were injected onto an Acclaim PepMap C18 nano-trap column (Thermo Scientific). After washing with 0.5% (vol/vol ...
-
bioRxiv - Biochemistry 2024Quote: The human BEST1 protein (spanning amino acids 1-398) was expressed in Pichia pastoris using the pPICZ vector (Invitrogen) with a C-terminal green fluorescent protein (GFP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The lysate was then further decolorized by gently shaking against an equal volume of Methyl tert-Butyl Ether twice and then Hexanes (Fisher Scientific). The aqueous layer was then recovered ...
-
bioRxiv - Microbiology 2022Quote: ... By measuring the absorbance of the supernatant at maximum wavelength for the Reactive Violet 5R (λmax = 558nm) and Methyl red (λmax = 420 nm) using Spectronic 20D+ (Thermo Scientific) the decolorization percentage was calculated using below equation,
-
bioRxiv - Cell Biology 2024Quote: The fluorescent cholesterol probe was tracked by incubating the cells with a final concentration of 20 μg/ml of TopFluor® Cholesterol (810255, Avanti) and 200 μg/ml of methyl-beta- cyclodextrin (C4555-1G, ThermoFisher) in PBS for 2 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Analysis of total 5-methyl-2ʹ-deoxycytidine (5-mdC) concentrations was performed using a Q exactive mass spectrometer (Thermo Fisher Scientific), equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were incubated at 60 °C for 5 min and then 2.5 μL of 200 mM MMTS (methyl methanethiosulfonate, Thermo Fisher, #23011) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... Media was removed from RPE1 cells and replaced with warmed 1x HBSS containing 1:500 dilutions of both Sytox Green nucleic acid stain (Life Technologies, S7020, 1:500 dilution) and Hoechst (Thermo ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Microbiology 2020Quote: ... The position of the Nucleic acids was visualized by chemiluminescent detection using the Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific) following manufacturer’s instructions and exposed to X-ray film (Amersham hyperfilm ECL ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Molecular Biology 2024Quote: ... and the manufacturer’s protocol was used with a substitution of 0.1% trifluoroacetic acid (TFA) with 0.1% formic acid (Optima LC/MS grade, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... Amino acid starvation media was prepared based on Gibco standard recipe omitting all amino acids and supplemented as above without addition of non-essential amino acids and substitution with dialysed FBS (Invitrogen). Media was changed 24 h before experiments.
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... amino acids 23-429) or pro- BMP10 (NP_055297.1, amino acids 22-424) was cloned into pcDNA3.1+ (Invitrogen/Thermo Fisher Scientific) downstream of the rat serum albumin signal peptide ...
-
bioRxiv - Genomics 2023Quote: ... 0.10% (v/v) formic acid in water and (B) 0.10% (v/v) formic acid in acetonitrile (LC-MS optima, Fisher Scientific). Gradient conditions were as follows ...