Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 4593 citations for 6 Chloronicotinohydrazide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Bone marrow was harvested from the long bones of C57BL/6 mice by flushing with Hank’s Balanced Salt Solution (HBSS, Gibco, UK). Cells were cultured overnight in DMEM containing 10% fetal bovine serum ...
-
bioRxiv - Genetics 2022Quote: ... and were seeded at 106 cells per well in neural expansion medium (NEM) in 6 well plates coated with Geltrex (A1413201, Gibco). This was considered as Passage 0 (P0) ...
-
bioRxiv - Microbiology 2022Quote: ... Enteroids were then washed with PBS three times with the addition of 4’,6-diamidino-2-phenylindole (DAPI) nuclear stain (1:5000) (Invitrogen) for the final 10 min wash ...
-
bioRxiv - Microbiology 2022Quote: Monocytes were isolated from the femurs of 6-12 week-old male C57BL/6 mice and differentiated into BMDMs for six days in 70% v/v RPMI 1640 medium (ATCC modification) (Gibco), 20% v/v L929 cell conditioned medium (provided by the Cell Services Science Technology Platform at the Francis Crick Institute) ...
-
bioRxiv - Physiology 2022Quote: ... The FDB was rapidly dissected free and pinned to the bottom of a sylgard-coated dish containing collagenase type II (6 mg/ml, Gibco) in standard Tyrode’s solution ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCRs were run using PowerUp SYBR green master mix on the QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems). Mouse primers used for qPCR:
-
bioRxiv - Neuroscience 2022Quote: ... embryoid bodies were embedded in 15 µL Matrigel droplets and cultured in 6 well plates containing c-organoid differentiation media consisting of 1:1 DMEM-F12 and Neurobasal media (Gibco), with addition of 0.5% N2 supplement (Life Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... The grids were blotted for 6 s and plunged into liquid ethane using a vitrification apparatus (Vitrobot, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: LF82 infected and control cells were lysed at 6 hours post-infection (hpi) for 15 min in radioimmunoprecipitation assay (RIPA) lysis buffer (ThermoFisher) supplemented with protease inhibitor (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative real-time PCR was performed on an ABI Quant Studio™ 6 Flex system (Applied Biosystems, Waltham, MA, USA) with SYBR Green PCR master mix (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... and reactions were performed in eight-link boards on QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems, USA) with cycling conditions (50 °C 2 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL Fugene HD transfection reagent and appropriate volume of Opti-MEM Reduced Serum Medium (31985070, Thermo Fisher, MA, USA) was prepared and incubated for 15 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... at 1,000g for 2min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Microbiology 2022Quote: ... and P323L/G671S N-terminally tagged with 6×His were purified using Bac-to-Bac™ Baculovirus Expression System based on the manufacturer’s instruction (Gibco). Upon 3 dpi of NSP12-enconding baculoviruses into Sf9 cells ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed in a 96-well plate using an Applied Biosystems QuantStudio 6 RT-PCR system (ThermoFisher Scientific). Reactions of 50 μLs in total volume were used which contained ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged once a week (∼80% confluence/well) at 1:4-1:6 ratios using 1mg/ml collagenase (Gibco) to detach colonies and onto fresh ir-MEF plates.
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuronal differentiations were carried out by plating 200,000 cells/12 well-well or 500,000 cells/6 well-well in DMEM/F12 base media (Gibco 11320-033) supplemented with B27 (Gibco 17504-044) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were resuspended in a flow-cytometry buffer and DAPI (4′,6-diamidino-2-phenylindole, 0.5 μg/ml; ThermoFisher #D1306) solution to exclude dead cells ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were washed 6 times for 20 minutes and incubated in secondary antibody (Alexa Fluor 488 goat anti-chicken-488, #A11039, Invitrogen) diluted 1:200 in 10% normal goat serum for 3 hours in the dark at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 3 µg RNA for each sample were mixed with 6 µl of ERCC ExFold RNA spike-in mixes diluted to 1:100 (Invitrogen). Next ...
-
bioRxiv - Immunology 2022Quote: ... primers are listed in Supplemental Table 3), Luminex using a custom procarta Luminex 6-plax-cytokines (IL1β, IL6, IL8, IL18, CCL2, and TNFa) detection kit (ThermoFisher) (Supplemental Fig ...
-
bioRxiv - Genomics 2022Quote: ... For each transfection 1.6 ug of plasmid DNA has been incubated for 20 minutes with 4 µl of Lipofectamine 2000 transfection reagent (Invitrogen) in 0.2 ml of OptiMEM media (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then fixed in 4% formaldehyde at room temperature for 10 minutes and mounted onto slides using ProLong Gold or Diamond Antifade Mountant with 4′,6-diamidino-2- phenylindole (DAPI) (ThermoFisher). Images were obtained using a Leica SP8 confocal microscope using excitation/emission spectra ...
-
bioRxiv - Neuroscience 2022Quote: ... CHO cells were plated at 1 x 106 cells/well in a 6-well plate and cultured for 24 hr in 2 ml of F12 medium (Gibco) supplemented with 10% FBS and 1% Glutamax (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... in a final volume of 12.5 μL per reaction in 384-wells PCR plates using a thermocycler (QuantStudio 6 Flex, Applied Biosystems). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthetized from 2ug of total RNA using MMLV-Reverse transcriptase and d(N)6 random primers in a 20ul reaction following the manufacturer’s protocol (ThermoFisher Scientific). RT-qPCR analyses were performed in triplicate using 2.5 μl of cDNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfer to a nitrocellulose membrane was done using 25 V for 6 min in the iBlot2 Gel Transfer device (IB21001, ThermoFisher). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DU145 cells were plated at 500 K cells per well on 6-well plates (Thermo Scientific™, Cat# 140675) coated with 10 µg/mL poly-D-lysine (PDL ...
-
bioRxiv - Biochemistry 2024Quote: ... plasmid DNA into 1 × 106 HEK293 cells plated per well of a 6-well plate using Lipofectamine 2000 transfection reagent (Invitrogen). Each well was transfected with 2 µg of total plasmid DNA (50 ng Cg4-puro ...
-
bioRxiv - Biochemistry 2024Quote: ... Reactions were performed at 30°C for 10 min and terminated by addition of 0.4% SDS and 6 × loading buffer (Thermo Scientific). The reaction mixture was loaded onto an 0.8% agarose gel in 1x TAE (40 mM Tris ...
-
bioRxiv - Biochemistry 2023Quote: Doxycycline-inducible C2C12 cells were seeded for most treatments at 0.1X106 cells per well in 6-well plates with 2 ml of DMEM [high glucose DMEM with pyruvate (Gibco, 12800), 3.7 g/L NaHCO3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the cDNA fragments in pENTR-D-TOPO were transferred to the modified pHAGE plasmids (6) using LR recombination (Invitrogen 56484).
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4′-6-diamidino-2-phenylindol) and Myosin Heavy Chain (Myosin 4, eFluor™ 660, Clone: MF20, Affymetrix eBioscience™). All images were taken using a confocal microscope (Zeiss LSM 780 Airyscan ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for PCR amplification was obtained by reverse transcription of RNA extracted from 6 dpf embryos with TRIzol (15596026, Invitrogen) using the QuantiTect Reverse Transcription kit (205311 ...
-
bioRxiv - Cancer Biology 2024Quote: 2×106 cells were seeded in 6 well plates and were incubated 24 hours later with 1uM of CellTrace Violet reagent (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... fowleri trophozoites were grown to near 100% confluency in 6-well TC-treated plates (Thermo Scientific Nunclon Delta Surface 140685). HEX (25 µM ...
-
bioRxiv - Biochemistry 2024Quote: Bacmids containing 6×His-MBP-TEV-nsp12 variants were generated using the Bac-to-Bac™ baculovirus expression system (Invitrogen). Sf9 cells were transfected with the bacmid DNA and baculovirus-containing cell supernatants were harvested 5 days after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... both at 1:300 dilution and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole; Invitrogen). Confocal microscopy (Olympus FLUOVIEW FV3000 ...
-
bioRxiv - Cell Biology 2024Quote: Protein concentrations of samples (fractions 6-9) were determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher, Rockford, USA), and Bradford assay (Biorad ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System using QuantStudio Real-Time PCR Software (both Applied Biosystems, Waltham, MA). TaqMan probes used were ...
-
bioRxiv - Physiology 2024Quote: ... Samples were heated at 65 ° for 6 minutes and quick chilled on ice prior to adding First strand buffer (Invitrogen) and DTT (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... reverse: CCAGTTGGTAACAATGCCATGT) was tested as SYBR assays using QuantStudio 6 Flex RealTime PCR reader (RRID:SCR_020239, Thermo Fisher Scientific, Waltham, USA). Afterwards ...
-
bioRxiv - Neuroscience 2024Quote: ... Hippocampal sections were stained with 4’,6-diamidino-2-phenylindole (DAPI) and cresyl violet or fluorescent Nissl (NeuroTrace 435/455 Blue, ThermoFisher). OFC and mPFC sections were stained to visualize glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Neuroscience 2024Quote: ... at 6 DIV with a total of 500ng DNA and 1.0 μl Lipofectamine 2000 reagent per well (11668019; ThermoFisher Scientific) in Opti-MEM reduced serum medium (31985062 ...
-
bioRxiv - Neuroscience 2024Quote: ... The slices were finally placed on 0.4 mm PTFE cell culture inserts (Millicell) equilibrated in a 6-well plate with serum-free media containing 1x B27 supplement (Gibco), 1x N2 supplement (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was again purified as above and a ligation reaction between 1:6 ratio of backbone:vector was carried out with T4 DNA ligase (Invitrogen, 15224017). Ligation mixture was incubated at 10 ...
-
bioRxiv - Immunology 2024Quote: ... We performed reaction in triplicates with 10 µl total volume using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). We normalized qPCR signal from ChIP DNA by 2% DNA input using the formula % of input = 100*2ᶺ(Ct [input]-Log2(50 ...
-
bioRxiv - Immunology 2024Quote: ... BHK-21 cells (7×105/well) were transfected in tissue culture-treated 6-well plates using Lipofectamine 2000 (ThermoFisher Scientific) with the LCMV Arm plasmids pCAGGS-NP (0.8 µg) ...