Labshake search
Citations for Thermo Fisher :
3151 - 3200 of 8294 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and isolated using a GeneJET plasmid miniprep kit (Thermo Fisher). Sequencing was performed by ELIM Biopharmaceuticals ...
-
bioRxiv - Genomics 2023Quote: ... and 1µg of gRNA plasmid using Neon electroporation (Life Technologies). A week after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pcDNA6.2/N-EmGFP-DEST obtained from Invitrogen (ThermoFisher). The CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: ... were cloned into a pFRT expression plasmid (Thermo Fisher Scientific) in frame with an N-terminal Gaussia luciferase (Gluc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and transforming the cloned plasmids into MAX EFFICIENCY DH10BAC (GIBCO) or EmBacY (Geneva Biotech ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected with the plasmids using Lipofectamine 3000 (Thermo Fisher) and cultured for 2 days at 37 °C and 5 % CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids were transfected into HeLa cells using Lipofectamine 3000 (Invitrogen). Imaging was performed 24-48 h following transfection in a HEPES-buffered ACSF solution (20 mM HEPES pH 7.3 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli colonies using the GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific). The variable region of the library (position 19 to 83 ...
-
bioRxiv - Immunology 2022Quote: ... and cloned into the plasmid vector pJet (Thermo Fisher Scientific). The mRNA was synthesized by in vitro transcription using a DNA template with T7 promoter Φ6.5 (TAATACGACTCACTATAGGG) ...
-
bioRxiv - Microbiology 2023Quote: ... protein expression from plasmid (derivates of pBAD-His/B (Invitrogen) in all cases except expression of VirF from pCL5 [71] ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNAs were transfected using Lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... plasmid was diluted in OptiMEM media (Reduced Serum Media, Gibco), mixed with PEI solution diluted in OptiMEM (3 μL PEI/μg DNA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and/or the indicated plasmid with Lipofectamine 2000 (Thermo Fisher, 24 h after RNAi treatment or 24 h before imaging/harvesting) ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA and plasmid transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pcDNA6.2/N-EmGFP-DEST obtained from Invitrogen (ThermoFisher). The CMV promoter ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with the following plasmids: pUNO1-hCIITA (Invitrogen), pRP-humanCIITA-3xFLAG (VectorBuilder) ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) following the manufactures instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid was transformed into Escherichia coli electrocompetent cells (Invitrogen, USA) following the manufacturer’s provided protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmids were transformed into chemically competent BL21(DE3) cells (Invitrogen) and grown overnight for 12–16 h at 37°C in 5 ml starter cultures in 2xYT medium with 50 μg/mL of kanamycin ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α cultures using the GeneJET Plasmid Miniprep (Thermo Scientific), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... pDProm was extracted with the GeneJET Plasmid Miniprep (Thermo Scientific), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The ligated plasmids were electroporated into DH10B ElectroMax cells (Invitrogen) and directly plated on 5,245mm2 dishes (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... coli using the Purelink HiPure Plasmid Midiprep Kit (Thermo Fisher).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... both plasmids were diluted in OptiMEM (51985, Thermo Fisher Scientific) at a concentration of 50 ng/mL and a Lipofectamine™ 2000 (11668 ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmid DNA (1ug) and PEI prepared in OptiMEM media (Gibco). Following an initial exchange for fresh media 16-24 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid was transformed into BL21(DE3) cells (Thermo Fisher) and purified using nickel Sepharose as described (Buser et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were transfected by electroporation (Neon transfection system, Life Technologies) according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: Cells were transiently transfected with plasmids using Lipofectamine 2000 (Invitrogen) or Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and packaging plasmids using lipofectamine 2000 (Thermo Fisher Scientific, 11668019) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... indicated plasmids were transfected using Lipofectamine 3000 (Thermo Fisher Scientific). After 24 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.25 µg envelope plasmid diluted in 100 µl optiMEM (Gibco) was mixed with 20 µl of PolyFect transfection reagent (Qiagen ...
-
bioRxiv - Biophysics 2023Quote: ... The template plasmids were digested by DpnI (Thermo Fisher Scientific), and the digested PCR products were ligated by Ligation High (TOYOBO) ...
-
bioRxiv - Microbiology 2023Quote: ... All plasmids were grown in TOP10 cells (Thermo Fisher Scientific) and verified by sequencing.
-
bioRxiv - Developmental Biology 2024Quote: ... with plasmid solutions mixed with SYBR Green (Thermo Fisher, S7563). Ef1a:mScarlet3 or Ef1a:Nr6a1-T2A-mScarlet3 plasmids were injected at a final concentration of 150-300 ng/µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... for plasmid DNA transfection or Lipofectamine 2000 (Thermo Fisher Scientific) for siRNA transfection or co-transfection of siRNA with plasmid DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids were transfected into cells using Lipofectamine LTX Reagent (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were transfected with Lipofectamine 2000 (Invitrogen Carlsbad, CA, USA) in accordance with the manufacturer’s instruction at a final concentration of 1 μg in a 60 mm dish ...
-
bioRxiv - Developmental Biology 2024Quote: ... the stock backbone plasmid was digested with Esp3I (ThermoFisher, ER0451), and double stranded oligos encoding each guide sequence were subsequently ligated into the vector ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid preparation of mini-ctx2 was digested using SacI (Thermofisher) and purified ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid transfection was carried out with Lipofectamine 3000 (Invitrogen, L3000075) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: Plasmids were transfected into cells using Lipofectamine 2000 (ThermoFisher Scientific) according to manufacturer’s protocol using a 1:3 ratio of plasmid to lipofectamine ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plasmid was transfected using Lipofectamine 3000 (Thermo Fisher, L3000015) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... all recombinant plasmids were constructed using Gateway technology (Invitrogen, USA). Genes of interest (GOI ...
-
bioRxiv - Systems Biology 2024Quote: ... The assembled plasmids were transformed into competent cells (C404003, Invitrogen). The plasmids were extracted with QIAGEN kits ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids of interest were transfected using Lipofectamine 3000 (Invitrogen, 100022052) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: ... transfer plasmid using 10 μL Lipofectamine 2000 (Thermo Fisher 11668) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µg plasmid DNA in 100 µl DMEM (Thermofisher, 41965039) without penicillin-streptomycin were combined with 2.4 µl Polyethylenimin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... The plasmid was linearized with XhoI (Thermo Fisher Scientific ER0691), and the probe amplified with Sp6 polymerase (Promega) ...
-
bioRxiv - Immunology 2024Quote: ... The plasmids were co-transfected into Expi293F cells (Thermo Fisher) using polyethylenimine transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lentiviruses were obtained by transient transfection of the psPAX2 packaging plasmid and pMD2.G envelope plasmid in HEK293T cells by using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Transfection efficiency was validated by western blotting ...