Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 8294 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... cortices of embryonic day (E) 18/19 Wistar rats were dissociated in trypsin with 0.25% EDTA (Gibco), washed after 20 min of digestion in plating medium (see below) ...
-
bioRxiv - Plant Biology 2023Quote: ... and Alexa Fluor 647 goat anti-rat IgM (μ chain) were purchased from Invitrogen (Eugene, OR, USA).
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded into a multi-layer system of collagen (rat-tail collagen used throughout; ThermoFisher # A1048301) and fibrin as shown in Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by incubation with secondary antibodies Donkey anti-Rat IgG-AF488 (Invitrogen A21208, RRID:AB_141709, 1:500 dilution) and Donkey anti-Rabbit IgG-AF594 (Invitrogen A21207 ...
-
bioRxiv - Immunology 2023Quote: ... Secondary antibodies 488 anti-chicken (1/500) and 647 anti-rat (1/500) were purchased from Invitrogen. For DNA and nuclei staining ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary antibodies were goat anti-mouse Alexa Fluor 488 or goat anti-rat Alexa Fluor594 (Invitrogen). The incubation with antibodies was accomplished in a humidified chamber for 1 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from rat tissues by using a combination method of Trizol (Thermo Fisher Scientific) and RNeasy Mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... Brain cortices from WT Wistar rats at post-natal day 1 were dissected in Hank’s buffer (Gibco), supplemented with 0.01 M HEPES ...
-
bioRxiv - Cell Biology 2022Quote: ... with a mixture of secondary antibodies containing Alexa Fluor 594 donkey anti-Rat (Invitrogen. Cat# A21209. RRID:AB_2535795) and Alexa Fluor 488 donkey anti-rabbit (Invitrogen Cat# A21209 ...
-
bioRxiv - Cell Biology 2022Quote: ... Target sequences for rat VAMP7 and syntaxin 4 were designed using the BLOCK-iT RNAi Designer (Invitrogen). Target sequences were subcloned first into the pcDNA6.2/GW-emerald GFP–miR cassette and then into the pRRLsinPPT viral expression vector (Ritter et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... eFluor™ 450 rat anti-mouse CD45 clone 30-F11 (ThermoFisher, 48-0451-82; 1:800 dilution), eFluor™ 450 rat anti-mouse TER-119 clone TER-119 (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated in monoclonal mouse anti-rat pSer202/pThr205 primary antibody (1:1000, Invitrogen, Massachusetts, USA). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... PDGFRα panning plates were coated with goat-anti-rat IgG (H+L) (7.5 µg/mL; ThermoFisher Scientific) in PBS with 0.2% BSA and rat anti-PDGFRα (1.5 µg/mL in PBS ...
-
bioRxiv - Immunology 2023Quote: ... and incubated for 4 hours at RT with a goat anti-rat-AF647 secondary antibody (polyclonal, Invitrogen). After secondary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... MEFs and naked mole-rat dermal fibroblasts were cultured in DMEM high glucose (41965-039, Life Technologies) supplemented with 15% FBS (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:1000 dilution and Alexa Fluor 647-labeled goat anti-rat secondary antibody (Invitrogen, A-21247) at 1:1000 dilution in blocking buffer for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The following secondary antibodies were used: 488 Alexa Fluor donkey anti-rat (Invitrogen, A-21208, 1:500), 555 Alexa Fluor donkey anti-rabbit (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... then incubated them overnight in rat anti-mCherry antiserum (1:2500; Thermo Fisher, Product#: M11217, Lot#: 2695213) and rabbit anti-CGRP antiserum (1:2500 ...
-
bioRxiv - Genomics 2024Quote: ... the slides were incubated with an anti-rat secondary antibody AF488 (diluted 1:400, A11006, Thermofisher scientific) for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... This was followed by staining with mouse-absorbed Alexa 488-conjugated goat anti-rat antibody (Molecular Probes) diluted 1:50 with PBS ...
-
bioRxiv - Systems Biology 2024Quote: ... and Alexa Fluor™ Plus 555 goat anti-rat (Thermo Scientific, cat no: A48263, 1/250 dilution). Nuclear signal was detected using DAPI (Thermo Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were transiently expressed with Lipofectamine 2000 or 3000 (Invitrogen) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfection with Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) was conducted 48 h after brown adipocytes were induced to differentiate ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer’s recommendations into HEK293T cells at 50% confluence the day of transfection along with lentiviral packaging plasmids pVSVg (3.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... transient transfections of plasmids were performed using Lipofectamine 2000 (Invitrogen) and cells were assayed 72 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and then cloned into the pENTR Gateway plasmid system (Invitrogen). The Entry plasmids were then recombined using the Gateway recombination cloning system (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA was transfected with Lipofectamine 2000 (Thermo Fisher Scientific) in U2OS cells according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transiently transfected with Lipofectamine 2000 (Thermo Fisher Scientific) according to the instruction of the manufacturer or with 10 mM PEI (Polyethylenimine ...
-
bioRxiv - Cell Biology 2020Quote: ... we used mito-mCitrine plasmid with TurboFect (ThermoFisher Scientfic, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The donor plasmid was assembled by MultiSite Gateway cloning (Invitrogen) and contained a GFP transcription unit under the control of the 3xP3 promoter enclosed within two reversible ϕC31 attP recombination sequences flanked both 5′ and 3′ by 2 kb sequence amplified using primer 29113 ex5 B1 f (CAACCAAGTAGTTACTGTGCTC ...
-
bioRxiv - Microbiology 2019Quote: ... we digested plasmids using EcoRI (Invitrogen™ Anza Restriction Enzyme). For the hCYTB484 assay ...
-
bioRxiv - Molecular Biology 2021Quote: All plasmids were transfected using Lipofectamine 2000 (Life Technologies, 11668019) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... and plasmid DNA were diluted in Opti-MEM (31985070, Gibco) to a final DNA:Lipofectmine ratio of 1:3 and incubated at room temperature for 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Control plasmids from ProQuest™ two-hybrid system (Life Technologies). Co-transformation with empty prey vector was used as negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... All plasmids were grown in DH5a competent cells (Life Technologies) and purified using endotoxin-free maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: ... PRF reporter plasmid DNAs were transfected using Lipofectamine 2000 (ThermoFisher) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid concentrations were measured using a Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and 260 ng pMD.G envelope plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with purified plasmids using lipofectamine 2000 (Invitrogen) (with a ratio of 1 µg DNA ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... PShuttle-CMV plasmids were then digested overnight with MssI (ThermoFisher) and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were selected for plasmid integration with geneticin (G418, ThermoFisher). MDCK Claudin-quintuple knockout (Cldn-qKO ...
-
bioRxiv - Microbiology 2020Quote: ... Minipreps were done using GeneJET Plasmid Miniprep Kit (Thermo Scientific) and quantified by NanoDrop ...
-
bioRxiv - Cancer Biology 2020Quote: The plasmid DNA was quantified using a NanoDrop spectrophotometer (Thermofisher), all the preps were adjusted to the same concentration of 25 ng/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid DNA was prepared in OptiMEM (Cat.# 31985070, Thermo Fisher). To produce virus for STEMCCA expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with LacR plasmid using Lipofectamine 2000 (Invitrogen) for 48 hrs ...
-
bioRxiv - Developmental Biology 2019Quote: ... A pCS2vegfcCDS plasmid was produced using Gateway LR clonase (Invitrogen). Capped mRNA was transcribed from a Not1-linearised template using the mMessage mMachine Kit (Ambion).
-
bioRxiv - Synthetic Biology 2019Quote: ... coli cultures using the PureLink Quick Plasmid Miniprep Kit (ThermoFisher). Input PCR products were purified using the GeneJet PCR purification kit (ThermoFisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... mESCs were transfected with plasmid vectors using Lipofectamine 2000 (Invitrogen) and then seeded at low density on dishes coated with feeder cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for plasmids and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) for siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with Endofree plasmid maxi kit (Qiagen).