Labshake search
Citations for Thermo Fisher :
3001 - 3050 of 7029 citations for Ammonium Polyphosphate phase II 02 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Sf9 cells were cultured in Sf-900TM II SFM medium (Gibco) and maintained at 27 °C and 90 r.p.m.
-
bioRxiv - Immunology 2022Quote: ... The viability of the cells was evaluated by Countess II (Invitrogen) and Trypan Blue (ThermoFisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gateway® LR Clonase® II enzyme mix (Thermo Fisher Scientific) was used according to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was reverse transcribed using Superscript II Reverse Transcriptase (Life Technologies) with random primers (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The bacmid was transfected to sf9 cells using Cellfectin-II (Invitrogen) to produce baculovirus ...
-
bioRxiv - Microbiology 2023Quote: ... or in Tab-Tek II CC2 chamber slides (Thermo Fisher Scientific). Separate wells were seeded for each assay to process ...
-
bioRxiv - Biophysics 2024Quote: The MDCK II cell lines were cultured in MEM (Gibco 410900028) with 5 % Fetal Bovine Serum (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... prostates were harvested and subsequently digested with collagenase type II (Gibco) for 2 hrs at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: SuperScript II Reverse Transcriptase 200 U (Life Technologies, Carlsbad, CA, USA)
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized using Superscript II RNase H-Reverse transcriptase (Invitrogen) and random hexamers (Applied Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... we utilized the Gateway BP Clonase II Enzyme Mix from Invitrogen to insert the 3’ UTR region into pDONR P2r-P3 Gateway entry vectors ...
-
bioRxiv - Genetics 2023Quote: ... The RT step was modified to utilize SuperScript II (Thermo Fisher) and a custom 5X First-Strand Buffer containing MnCl2 (250 mM Tris-HCl ...
-
bioRxiv - Genetics 2023Quote: ... and cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen). The HAC1 spliced and unspliced fragments were amplified with intron-spanning primers (ACCTGCCGTAGACAACAACAAT and AAAACCCACCAACAGCGATAAT ...
-
bioRxiv - Genetics 2023Quote: ... 1 unit of Phusion Hot Start II DNA Polymerase (Thermo Fisher), 10 ul of 5X HF buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... by using Gateway® LR Clonase® II enzyme mix (Invitrogen). PCR fragments of about 400-600 bp of single MtYUCs and MtPINs genes for RNAi constructs were generated on cDNA made from Medicago nodule or root RNA ...
-
bioRxiv - Genetics 2024Quote: ... we used Phusion Hot Start II DNA Polymerase (Thermo Scientific F549L) to amplify 2000 bp upstream of efk-1 start codon ...
-
bioRxiv - Neuroscience 2024Quote: ... and counted on a Countess II automated cell counter (Invitrogen AMQAX1000) to quantify viable cells.
-
bioRxiv - Molecular Biology 2024Quote: ... using a XCell II™ Blot Module (Invitrogen, Carlsbad, CA, USA). Membranes were then probed with crude SelN antibody 7637 raised in rabbit (1:500) ...
-
bioRxiv - Microbiology 2023Quote: ... or RS treated glass chamber slides (154526, Nunc, Lab Tek II). Overnight S ...
-
bioRxiv - Biochemistry 2023Quote: ... reverse transcription was performed with Superscript II reverse transcriptase (Thermo Scientific) at 42 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Phire Green Hot Start II PCR Master Mix (Thermo Fisher, #F126L) was used according to manufacturing instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... pEarleyGate104 and pEarleyGate201 destination vectors (56) via LR Clonase II (Invitrogen) from their entry vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SuperScript II Reverse Transcriptase (Invitrogen Thermo Fisher Scientific; Cat #18064014) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... cDNA conversion was performed combining the SuperScript II Reverse Transcriptase (Invitrogen) with the Reverse Transcription System kit (Promega ...
-
bioRxiv - Immunology 2023Quote: ... Viability and cell count were assessed using a Countess II (ThermoFisher). Equilibrium to targeted cell recovery of 6,000 cells along with Gel Beads and reverse transcription reagents were loaded to Chromium Single Cell A to form Gel-bead-in Emulsions (GEMs) ...
-
bioRxiv - Pathology 2024Quote: ... and SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was carried out on StepOnePlus (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Reverse transcription (RT) was performed using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: Cells were counted on a Countess II automated cell counter (ThermoFisher) and 12,000 cells were loaded on to one lane of a 10X Chromium microfluidic chip ...
-
bioRxiv - Cell Biology 2022Quote: Spdoptera frugiperda (Sf9) cells were cultured in SF900 II SFM (Gibco) at 27°C with orbital shaking at 120 rpm.
-
bioRxiv - Molecular Biology 2022Quote: ... The “Phusion Hot Start II DNA Polymerase” (Thermo Fisher, MA, USA) was used for PCR amplification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Phusion Hot Start II DNA polymerase (Thermo Scientific, catalog no.: F549L) was used along with the Phusion HF buffer provided ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples in 1X formamide loading buffer (Gel loading buffer II – Ambion) were heated for 5 min at 95 ºC prior to analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... and the Super Script II kit(Invitrogen, Carlsbad, California, United States) following manufacturer’s instructions with the addition of Rnasin (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: E10.5 limb buds were dissected and incubated in Dispase II (Gibco) solution for 30min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen #18064022), and qPCR was carried out using 1.5 µl of cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, USA). qRT-PCR was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... using Gateway™ BP Clonase II Enzyme Mix (Thermo Fisher Scientific) and subsequently into pUB-RFP-DEST (Grefen et al. ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using Super Script II Reverse transcriptase (Thermo Fisher Scientific) and Expanded High Fidelity PCR System (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed with SuperFi II PCR master mix (Invitrogen). The fragments were then joined by PCR ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was prepared using Superscript II first strand synthesis kit (Invitrogen). Taqman gene-specific RT-PCR primer pairs were used with the ABI Prism 7000 (as follows ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA was then synthesized by reverse-transcriptase (Superscript II, Invitrogen). The primers used for NifD ...
-
bioRxiv - Neuroscience 2022Quote: ... immediately followed by reverse transcription using the Superscript II system (Invitrogen) with oligo(dT ...
-
bioRxiv - Immunology 2022Quote: ... Super Bright 645-labeled MHC II (M5/114.15.2, Thermo Fisher Scientific), BV421-labeled PD-L1 (MIH5 ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse-transcribed using SuperScript II (Thermo Fisher Scientific, 18064-022). Real-time PCR was performed using the primers (F ...
-
bioRxiv - Bioengineering 2023Quote: ... and cloned into pCR-Blunt II-TOPO® (Thermo Fisher Scientific). cDNAs were incorporated into pcDNA3 (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell number was determined (Countess II F2, Thermo Fisher Invitrogen), and 3 ∙ 107 cells were used for each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell number was determined (Countess II F2, Thermo Fisher Invitrogen), and 3 ∙ 107 cells were used for each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Hi Five cells grown in Sf-900 II SFM media (Gibco) at a density of 2.0 × 106 cells/mL were infected with baculovirus at 1.5% v/v ratio ...
-
bioRxiv - Biochemistry 2022Quote: ... The sen cDNA was ligated into plasmid blunt II Topo (Invitrogen) and then transformed into TOP10 competent Escherichia coli cells ...
-
bioRxiv - Biochemistry 2022Quote: ... falciparum actin II was expressed in Spodoptera frugiperda Sf9 cells (Invitrogen) at 27°C ...