Labshake search
Citations for Thermo Fisher :
2751 - 2800 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Insulin Receptor β CT-3 mouse monoclonal antibody (1:1000, AHR0271, ThermoFisher), Perilipin-1/PLIN1 D1D8 rabbit monoclonal antibody (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... cells were passaged 1:15 every 3 days using trypsin (Gibco, 25300054) and centrifugations at 200 xg ...
-
bioRxiv - Cell Biology 2024Quote: ... and replaced with M2 containing 1 μM TO-PRO-3 iodide (ThermoFisher). A SpectraMax i3X multimode detection platform equipped with a MiniMax cytometer (Molecular Devices ...
-
bioRxiv - Plant Biology 2023Quote: ... and precipitated with 1/10 volume of 3 M Sodium Acetate (Invitrogen), 2 μL GlycoBlue (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... transfection reagent at a ratio of 1:3 DNA:Fugene in optiMEM (Gibco). SARS-2 PV were harvested at 48h post transfection and supernatant filtered through a 0.45 μm acetate cellulose filter (Starlab ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were counterstained with TO-PRO™-3 Iodide (Invitrogen, 1:2000). For immunofluorescence detection of DEK or PCNA cells were fixed with 4% PFA/PBS (20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... and extracted total RNA using BCP (1-bromo-3-chloropropane; Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... mouse anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:50000, Thermo Fisher, AM4300), mouse anti-CASQ1 (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... following a 3-hours treatment with 100 ng ml−1 colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were incubated with TO-PRO-3 Iodide (1:1000, Life Technologies) in 1x PBS for 20 minutes and then mounted with VectaShield mounting media (Vector Laboratories) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Synthesized cDNA was diluted 1:3 and QS5 or QS6 (Life Technologies) systems were used for performing RT-qPCR analyses ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were split every 5-6 days using TrypLE Express (Gibco, #12604013). Each dome required 20-25mins in TrypLE Express with manual pipetting for successful dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µl Klenow-Fragment exo-polymerase (Thermo Fisher, 5 U/µl) were added ...
-
bioRxiv - Microbiology 2019Quote: ... day 1 (24 hours) and day 3 (72 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... a mix of PEImax (1 μg/μL) with expression plasmids (312.5 μg/L) in a 3:1 ratio in OptiMEM (Gibco) were added to the cells ...
-
bioRxiv - Immunology 2022Quote: Supernatants were collected 3 days post Dynabeads™ Human T-Activator CD3/CD28 (1:1 beads:Treg cell ratio, Gibco) stimulation for analysis of cytokine production using a Luminex-based multiplexed assay (Th1/2/9/17 18-plex Human ProcartaPlex Panel ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 mM NaCl, 3 mM MgCl2, 1 mM dithiothreitol, 1% BSA, 0.1% Tween 20, and 0.6 U/mL RiboLock [Thermo Fisher]). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Microbiology 2023Quote: ... containing 3 mL of home-made Expansion Medium consisting of a 1:1 mixture of DMEM/F-12 (Gibco) and Neurobasal Medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 1 µL mouse anti-V5 primary antibody (1:10,000; R96025, Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM Aminoguanidine and 2.5 mM Sodium Ascorbate the reaction allowed to proceed for 6h at room temperature before removal of the biotin excess using Zeba desalting columns (7kDa cut-off, Thermofisher). The samples were then combined altogether at a 1:1:1 ratio within one replicate ...
-
bioRxiv - Genomics 2024Quote: ... Cells were harvested for RNA extraction at 6h and 24h from unstimulated and stimulated PBMCs using TRIzol® (Life technologies) reagent according to manufacturer’s instructions and treated with DNase to ensure elimination of genomic DNA ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA was radioactively 5' end-labeled using 1 U μl−1 T4 polynucleotide kinase (Thermo Fisher Scientific) and 0.5 μCi μl−1 32P-γ-ATP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μl 10 μM 5‘-biotinylated oligo-dT30VN (IDT) and 1 μl 10 mM dNTP (Thermo Scientific). Cells were sorted at one cell per well ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4 old (7 months) male fish were dissected immediately into cold PBS (pH 7.4, Gibco). The dissected brains were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged every 3-7 days as single cells using TrypLE™ Select CTS™ (Gibco). The ROCK inhibitor Y27632 (Fujifilm ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Taqman® assays (Supplementary table 3) and QuantStudio™ 7 Flex Real Time PCR system (ThermoFisher, USA), and relative expression levels determined using QuantStudio™ 7 Real Time PCR software.
-
bioRxiv - Neuroscience 2019Quote: ... unc-7 rescue plasmids were made using the Multisite Gateway® 3-Fragment Vector Construction Kit (Invitrogen). A 1078bp mec-4 promoter fragment (as previously used ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: Antibody-bead conjugates were prepared as follows: One hundred μL of protein G Dyna beads (Thermo Fisher Scientific) were washed three times in PLB and were resuspended in 1 mL of PLB ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were grown for one week in amplification medium (AM) containing high-glucose (4.5 g/l) Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Molecular Biology 2022Quote: ... We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific; 1 h, 22 C). The ligation mix was purified (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... Vacuolar membranes were stained with 1 μL of 1 mg/mL solution of FM 4-64 (T3166; Invitrogen) in DMSO added at the beginning of incubation of cells in YPD medium ...
-
bioRxiv - Cell Biology 2024Quote: ... AlexaFluor 488 anti-rabbit (1:1000, green) and 568 anti-mouse (1:1000, red) (both Invitrogen; Table 4) secondary antibodies were also diluted in 1% BSA and 10 % goat serum in TBS and incubated in the dark for 45 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 μL Tris pH 6.5 1 M and 1 μL Proteinase K (20 mg/ mL, Thermo Fisher Scientific) and incubated shaking for 3 hours at 45°C ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies were incubated at 4°C overnight (Abcam, ab138501, 1:1,000; Thermo Fisher Scientific, AM4302, 1:5,000). Horseradish peroxidase-conjugated secondary antibodies were incubated for 1 hr at room temperature (Abcam ...