Labshake search
Citations for Thermo Fisher :
3001 - 3050 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the media was changed to retinal differentiation medium (RDM;DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX) ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibody in PBS supplemented with 3% BSA (Thermofisher, Mouse 800, 1:20000 and Thermofisher, Rabbit 680, 1:20000) was incubated in the dark for 1 hour on a rolling platform at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:3) (60) followed by secondary Alexa Fluor 488 goat α-mouse IgG antibody (Invitrogen / Thermo Fisher Scientific – 1:1,000).
-
bioRxiv - Neuroscience 2023Quote: ... the brains were placed in the secondary antibody solution containing 1xPBS/0.1% Triton X-100/3% donkey serum and a 1:1000 dilution of donkey anti-sheep 647 (A-21448, Thermofisher) for 10 days.
-
bioRxiv - Cancer Biology 2023Quote: ... Buffy coat was mixed 1:2 with PBS and added onto a Ficoll gradient in a 3:1 ratio (Invitrogen). This was centrifuged at 2100 rpm for 25 minutes at RT (w/o brakes) ...
-
bioRxiv - Systems Biology 2023Quote: ... The bottom tips were packed sequentially with three plugs of C18 membrane (3 M Empore) and mixed-mode ion exchange beads (SCX:SAX = 1:1, Applied Biosystems). The quantity of C18 membrane and mixed-mode ion exchange beads was adjusted based on the protein amount.
-
bioRxiv - Bioengineering 2023Quote: ... was reduced on the 78 ± 3 nm cores using 1 ml of 1 mM L-ascorbic acid (AA) (Fisher Scientific), making core@shell structures ...
-
bioRxiv - Physiology 2024Quote: ... WT and Mrp14-/- bone marrow neutrophils (2.5×106 mL-1) were resuspended in PBS and loaded with 3 µM Indo-1 AM (Invitrogen™) for 45min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4) for 10mins and later incubated with 4 uM fluo-4/AM (1 mM, Molecular probes, #F14201) and 0.002% pluronic F-127 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were split every 5-7 days by incubation with 0.5 μM EDTA (Thermo Fisher Scientific) for 4 min at room temperature and clumps were dissociated into small clumps by pipetting ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were grown at 37 °C under 5% of CO2 in DMEM Glutamax (Gibco) with 10% bovine fetal serum ...
-
bioRxiv - Neuroscience 2023Quote: ... 15-20 pooled day 30 neurospheres and 5-7 pooled day 60 organoids using TRIzol (Invitrogen; Thermo Fisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM MgCl) with Zeba™ Spin Desalting Column with a 7 kDa MWCO (Thermo Scientific). The protein was used to prepare a serial dilution in a black 384-well ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were incubated for 5 min with Hoechst (1:10000; Invitrogen) to visualize the nuclei and mounted with Mowiol (Calbiochem).
-
bioRxiv - Neuroscience 2021Quote: ... 5% glycerol) with 1% Halt protein/phosphatase inhibitor (ThermoFisher Scientific; 78446). Samples were spun at 17,100xg for 15 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 mM EDTA) and 1 μl Exo-resistant random primers (Thermofisher), heated for 5 minutes at 98°C and then cooled down at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were dislodged by incubating in 1:5 TrypLE (Gibco) in EBSS for ~10 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 or 5 µg/ml of Proteinase K (PK) (Thermo Fisher), during 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 primary and anti-human Alexa 633 (Thermo Fisher; 1:200) secondary antibodies.
-
bioRxiv - Microbiology 2019Quote: ... 0.5 µL Taq polymerase (5 U µl−1, Invitrogen, United States) and 5 µL template DNA (50 ng µL−1 ...
-
bioRxiv - Biophysics 2020Quote: ... were coated with 5 mg⋅mL−1 neutravidin solution (Thermo Fisher) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with DAPI for 5 minutes (1:1000; Thermo Fisher Scientific) and mounted with ProLong Gold mounting medium (Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... anti-Claudin-5-Alexa Fluor 488 (1:1000 dilution, 352488, Invitrogen), mouse anti-GBP2 (1:100 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA (1-5 μg) was treated with Turbo DNase (Invitrogen) and reverse-transcribed using Tetro Reverse Transcriptase (Bioline Meridian Biosystems ...
-
bioRxiv - Biophysics 2019Quote: ... 1-5 µL (10pg-100ng) pRSET-EmGFP plasmid (Invitrogen, CA, USA) was mixed with 25 µL thawed bacterial solution and incubated for 5-10 minutes on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... polyclonal rabbit anti-mouse/human claudin-5 (1:300; Life Technologies), polyclonal rabbit anti-mouse/human ZO-1 (1:200 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary polyclonal rabbit antibodies against claudin-5 (1:500; Life Technologies) and ZO-1 (1:250 ...
-
bioRxiv - Cell Biology 2020Quote: ... Hoechst 33342 (Life technologies, H3570, final concentration 5 μg ml-1) and Alexa Fluor-488/647 Phalloidin (H3572 ...
-
bioRxiv - Physiology 2020Quote: ... 5 μl DNase I buffer and 1 μl Turbo DNase (Invitrogen) was added to each sample and incubate for 15 m at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... for BSR-T7/5 cells and 1% Gentamicin (Thermo Fisher Scientific) and 0.2% Fungizone (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 5 mM Hepes and 1 mM glutaMax I (all from Invitrogen) in an RPMI-1640 base ...
-
bioRxiv - Biophysics 2022Quote: ... followed by 1 h in 5% acetic acid (Fisher Scientific, 10171460), and then washed thoroughly in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μg/mL FM 1-43 (Thermo Fisher Scientific Ref. T35356) to label membranes or 100 nM SiR-DNA (Spirochrome Ref ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 5 min incubation with 1 mg/ml NeutrAvidin (Invitrogen) in MRB80 buffer ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl DRAQ5 (5 mM solution; Thermo Fisher, cat. no. 62251) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... Saturated cultures were serially diluted 1:5 in sterile PBS (Gibco). To SC –ura -his glucose or galactose agar plates ...
-
bioRxiv - Molecular Biology 2022Quote: ... Multidrop™ Combi Reagent Dispenser (ThermoFisher, green in scheme 1-5) or manually (grey in scheme 1-5).
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit-hosted antibodies [anti-Claudin-5 (1:100, 34-1600, Invitrogen), and anti-Iba-1 (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Dihydrochlorid (DAPI) for 5 min (1:100, #D1306, Invitrogen, Waltham, US). Samples were mounted on glass slides and z-stacks were acquired using an LSM900 confocal laser scanning microscope (Carl Zeiss ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% NP-40 and 5 mM EDTA) (Thermo Scientific, J60766-AP) supplemented with Halt Protease Inhibitor Cocktail (Thermo Scientific ...