Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... falciparum strain 3D7 parasites were grown under 5% O2 and 5% CO2 in RPMI-1640 media supplemented with 5 g/L Albumax II (Life Technologies), 2 g/L sodium bicarbonate ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were generally plated on Luria-Bertani (LB) agar (10 g/L peptone, 5g/L yeast extract, 5 g/L NaCl, 12 g/L agar) (Thermo Fisher Scientific, Waltham, MA, USA) containing the respective antibiotics and incubated at 37°C overnight.
-
bioRxiv - Neuroscience 2022Quote: Differentiated cells on day 15 (8 days suspension culture plus 7 days adherent culture) were harvested and dissociated using TrypLE Select (Gibco). Cells were then passed through a 20 µm strainer and resuspended in 1 x PBS with 0.04% BSA buffer ...
-
bioRxiv - Immunology 2020Quote: PBMC were seeded at a concentration of 7-8 × 106 cells/mL in RPMI 1640 medium without phenol red and glutamine (Gibco) supplemented with 10% heat-inactivated FBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: Lipid overlay assay was performed using PIP strips (nitrocellulose membrane spotted with 8 phosphoinositides and 7 other biologically relevant lipids) according to the manufacturer’s instructions (Thermo Scientific). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative real time PCR (n = 7–8 per genotype) was performed on an ABI 7300 Sequence Detection system (Applied Biosystems) using the PowerUp SYBR Green Master Mix Kit (Applied Biosystems).
-
bioRxiv - Bioengineering 2024Quote: ... 200 μl of antibody or scFv at 1 mg/ml in PBS was mixed with 10% volume of 1M sodium bicarbonate to adjust pH to 7-8 followed by addition of EZ-Link sulfo-NHS-LC-Biotin (ThermoFisher) to reach a 5:1 biotin:protein molar ratio ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Microbiology 2020Quote: ... just-subconfluent T150 flasks were transfected with 8.75 μg of HIV-1 YU2 or HIV-1 YU2 lacking Vpr (HIV-1 YU2 ΔVpr) and 30 μl Fugene 6 in 500 μl Optimem (Thermofisher Scientific). To make VSV-G pseudotyped HIV-1 GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Rosettes were plated on growth factor reduced matrigel coated 6 well plates in ‘pNPC medium’ composed of a 1:1 mixture of Neurobasal (ThermoFisher Scientific) and DMEM/F12 ...
-
bioRxiv - Microbiology 2024Quote: ... ten-fold serial dilutions from 10-1 to 10-6 of media from infections were prepared in 1 x PBS (Gibco, #14190250). The media on Vero cells seeded the previous day was aspirated ...
-
bioRxiv - Cell Biology 2023Quote: ... to a final detergent:dye ratio of 16 g/g before running on a 3-12% NativePAGE Mini Protein Gel (Thermo Fisher Scientific) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and stable integrants resistant to 1.5 g/L 5-fluoroorotic acid (5-FOA) (Fisher Scientific, Hampton, NH) were isolated ...
-
bioRxiv - Immunology 2022Quote: ... followed by incubation for 8 min using 5 μM CellTrace Violet dye (Invitrogen). Following fluorescent labeling ...
-
bioRxiv - Microbiology 2022Quote: Vero cells were cultured for 5−8 passages in DMEM medium (Gibco, USA) with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Developmental Biology 2019Quote: Posterior midguts of 7 day-old adult flies were directly homogenized in 1 ml TRIzol (Life Technologies) and total RNA was isolated according to the manufacturer’s protocol (miRNeasy mini kit ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were harvested at DIV7 (Day 1) or DIV14 (Day 7) in N-PER (87792 Thermo Scientific) supplemented with protease inhibitors (cOmpleteTM Ultra ...
-
bioRxiv - Pathology 2023Quote: ... followed by 7 min incubation with SYTOX green Nucleic Acid Stain (Invitrogen S7020; 1:700 in ddH20) at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Zebrafish cDNA was prepared from RNA extracted from AB zebrafish (1–7 dpf) using Trizol (Ambion #15596026) and phenol:chloroform (Millipore #19K0856166) ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HIEC-6 cells were seeded onto 8-well Lab-Tek glass chamber slides (Nunc, Rochester, NY) at 10,000 cells/well ...
-
bioRxiv - Biochemistry 2019Quote: ... Knockdown of PALB2 (Buisson et al., 2017a) was performed 6-8 h later using Lipofectamine RNAiMAX (Invitrogen). Twenty-four hours post-transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... were isolated from embryos incubated for between 6 (E6.0) and 8 (E8.0) days and maintained in chilled Leibovitz’s L-15 media (GIBCO, Invitrogen). Papillae were dissected as described previously 65 and cultured nerve-side-down on Millicell cell culture inserts (Millipore ®) ...
-
bioRxiv - Immunology 2023Quote: ... 6 to 8 samples were pooled and loaded on the Ion 530™ Chip (Thermo Fisher Scientific) using the Ion Chef™ Instrument (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The suspension was incubated at 25°C for an additional 2 hr with Protein G SepharoseTM 4 Fast Flow or DynabeadsTM Protein G (Invitrogen), pre-blocked with 1 mg/ml BSA and 0.25 mg/ml Salmon Sperm DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 μg of plasmid VSV-G encoding G glycoprotein of vesicular stomatitis virus(VSVG) using Lipofectamine 3000 Reagent (Invitrogen). 12 h later ...
-
bioRxiv - Cancer Biology 2021Quote: ... and phosphatase/protease inhibitors in water) and addition of a 1:1 ratio of protein A and G magnetic beads (Life Technologies) were used to bind crosslinked protein/DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mL of cells (OD600 < 1.0) was spun down at 10k g-force for 1 min (Thermo Fisher Scientific, Pico 17), resuspended in 200 μL SCGE and sonicated for 5 s (Bandelin electronics ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 mg of striatal lysates was pre-cleared for 1 h with 80 ul Protein G Sepharose coated beads (ThermoFisher Scientific), then centrifuged at 4°C for 5 min at 1000 rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-IgG 1:500, rabbit anti-Dp 212 1:500 (Dimova et al, 2003) and Dynabeads protein G (Invitrogen # 10003D). Chromatin precipitate was eluted from Dynabeads with elution buffer 1 (10mM EDTA ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with TBS-T and incubated for 1 h at room temperature with an HRP-conjugated anti-mouse (dilution 1:50,000, Invitrogen, G-21040) or anti-rabbit (dilution 1:50,000 ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were mixed with 30 μl ChIP-grade protein A/G plus agarose beads (1: 1 slurry, ThermoFisher Scientific 26159) for 1 hour at 4°C ...
-
bioRxiv - Genetics 2024Quote: ... Then chromatin was pre-cleared with 10 μl of 1:1 protein A:protein G Dynabeads (Thermo Fisher Scientific, 10001D and 10003D). The precleared chromatin sample was incubated with 0.5 μg of anti-H3K4me3 (Millipore 17-614 ...
-
bioRxiv - Genomics 2023Quote: The MNase digested chromatin solution of each sample was pre-cleared with 100μl Dynabeads Protein A/G 1:1 mix magnetic beads (Invitrogen 10001D, 10003D) and rotated at 4℃ for 2h ...