Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI) for nuclear staining (Fluoromount-G™ Mounting Medium, with DAPI, Invitrogen), and incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 mM NEAA + DMEM/Sodium Bicarbonate (2.438 g/L) media in 6-well plates (Thermo Fisher). After 48 hours cells were scratched ...
-
bioRxiv - Bioengineering 2021Quote: ... 30 g of Todd-Hewitt Broth (BD Bacto™ THY, Fisher Scientific, Cat# DF0492-17-6) and 2 g of Yeast Extract (United States Biological Corporation ...
-
bioRxiv - Biophysics 2024Quote: ... cells were pelleted at 400 g for 6 minutes and resuspended in Staining Buffer (eBioscience, ThermoFisher) at a concentration of 3x106 cells/mL ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cancer Biology 2021Quote: ... resuspended in 2% FBS in HBSS containing 5 g/ml DAPI (Invitrogen), and sorted into DMEM containing 10% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysate were mixed with NativePAGE 5% G-250 Sample Additive (Invitrogen, BN20041) and resolved on a 3%-12% gradient native gel (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... enhanced with 5 g/l of Albumax II (Thermo Fisher Scientific, 11021037), 0.12 mM hypoxanthine (prepared by adding 1.2 ml of 0.1M hypoxanthine to 1 M NaOH) ...
-
bioRxiv - Cell Biology 2020Quote: ... One portion was incubated for 16 h at 4°C with Dynabeads (Thermo Fisher Scientific) directly conjugated to anti-CD9 antibody with rotation ...
-
bioRxiv - Cancer Biology 2022Quote: ... proteins were separated by one-dimensional gel electrophoresis (4–12% NuPAGE Bis-Tris Gel; Invitrogen), and the entire lane of a Coomassie blue-stained gel was cut into 23 slices ...
-
bioRxiv - Molecular Biology 2019Quote: ... One fourth of the eluted samples was separated on 4-12% NuPage gels (Life Technologies) and the gels stained with coomassie blue (ProtoBlue ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures (n=3) were transferred as one sample into 250 μl RNAlater (ThermoFisher, Cat# AM7020) and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were resolved for 4 hr at 100 V on 4% −8% polyacrylamide gradient Tris-acetate denaturing gels (Novex, Life Technologies) and transferred to PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: HEK293T cells were seeded at the density of 106 cells/well in a 6-well plate and were grown overnight in complete DMEM/F12 1:1 Glutamax ™ (Thermofisher, UK). On the next day ...
-
bioRxiv - Developmental Biology 2024Quote: ... hESC were diluted at ratios between 1:6 and 1:50 using 0.5 mM EDTA-PBS (Thermo Fisher Scientific, catalog no. 15575020).
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Genetics 2020Quote: ... him-8(tm611) germlines were immunostained with 1:500 rabbit anti-GFP (Thermo Fisher A-11122), and all other germlines were stained with 1:2000 mouse anti-FLAG (Sigma F1804 ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were resuspended in PBS containing 8 μg ml-1 Alexa Fluor 647 NHS ester (Invitrogen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: ... and plated onto Matrigel-coated wells in Essential 8 medium containing Revitacell (1:200 dilution; Gibco) at 3.9 × 104/cm2 in 12-well cell culture plates ...
-
bioRxiv - Cell Biology 2022Quote: ... the hiPSCs were resuspended in 1 mL of Essential 8 Flex Basal Medium (Thermo Fisher Scientific) and were plated in agarose inserts at two different cell densities ...
-
bioRxiv - Cancer Biology 2020Quote: ... except C3H/10T 1/2 Clone 8 was cultured in Eagle’s Basal medium (Thermofisher, #21010-046) supplemented with HI-FBS to a final concentration of 10% and 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2020Quote: ... THP-1 cells were cultured in RPMI supplemented with 8% FBS and antibiotics (penicillin, streptomycin, GIBCO) at 37°C with 10% CO2 in a humidified incubator ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 μg of purified bacmid plasmid DNA was mixed with 8 μL of Cellfectin II (ThermoFisher) at room temperature to transfect 0.9×106 Sf9 cells per well in a 6-well tissue culture plate in a semi-humid environment ...
-
bioRxiv - Microbiology 2023Quote: ... HCT-8 cells (ATCC CCL-244) and THP-1 cells were maintained in RPMI-1640 (Invitrogen), supplemented with 10% HyClone Cosmic calf serum (Cytiva) ...
-
bioRxiv - Molecular Biology 2023Quote: 1 x 107 cells at the exponential growth phase were labeled with 8 µM CFSE (Invitrogen) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were then stained with DAPI (4’,6- diamidino-2-phenylindole, dihydrochloride, ThermoFisher, 62247 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...