Labshake search
Citations for Thermo Fisher :
2651 - 2700 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µL/well using a Multidrop Combi (ThermoFisher). 50 nL of compounds in DMSO was added to target wells using an acoustic liquid handler (Labcyte Echo 500) ...
-
bioRxiv - Pathology 2023Quote: ... 5 mg/ml endothelial cell growth factor (Gibco), and antibiotics on culture plates pre-covered with 0.5% gelatin and 100mg/ml collagen type I (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... IL-5 and IL-13 (Invitrogen, Massachusetts, USA) were all measured according to kit protocols ...
-
bioRxiv - Bioengineering 2023Quote: ... supplemented with 5% v/v horse serum (Gibco), 1% v/v Penicillin-Streptomycin solution (Gibco) ...
-
bioRxiv - Genetics 2023Quote: ... was added to 5 ul R buffer (Invitrogen) and incubated for 10 minutes prior to transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... medium supplemented with 5% fetal bovine serum (Gibco), 5 μg/ml Bovine insulin (Cell Applications) ...
-
bioRxiv - Physiology 2024Quote: ... and then blocked with 5% goat serum (Invitrogen) in PBST for 45 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μM MitoSOXTM Red (Thermo Fisher Scientific, M36008) and 1 μM Fluo-4 AM (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% glycerol and 50x Dynabeads MyOne (ThermoFisher#65601) was applied on the grid ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% CO2 on Coating Matrix Kit Protein (Gibco) coated flasks ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% CO2 and passaged using Trypsin (Gibco, #15400054) in the presence of an anti-antimycotic antibiotic (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... medium supplemented with 5% fetal bovine serum (Gibco), 100 U/mL penicillin and streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and QuantStudio™ 5 (Thermo fisher scientific, USA). PCR primers were generated from the Primer Bank database ...
-
bioRxiv - Biophysics 2024Quote: ... with 5 μL of Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5 % fetal bovine serum (FBS, Gibco). Penicillin and streptomycine (final concentrations 100 U mL−1 and 100 µg mL−1 ...
-
bioRxiv - Biophysics 2024Quote: ... 5% horse serum (16050-122, Thermo Fisher Scientific), 20 ng/ml EGF (AF-100-15-1MG ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS; Invitrogen), glutamine (2 mM) ...
-
bioRxiv - Genomics 2024Quote: ... 350µL Acid Phenol:chloroform (5:1; ThermoFisher cat# AM9720), and 350µL NETS (300mM NaCl ...
-
bioRxiv - Genomics 2024Quote: ... and 5 ng/mL bFGF (ThermoFisher Scientific, PHG0367) at 37°C and 5% CO2 ...
-
bioRxiv - Biochemistry 2024Quote: ... supplemented with 5% Horse Serum (Invitrogen, 16050-122), 0.02 ug/mL EGF (Peprotech ...
-
bioRxiv - Developmental Biology 2024Quote: ... in a Cytation 5 imaging reader (Thermo Fisher). Protein samples were prepared using the Laemmli buffer (Biorad ...
-
bioRxiv - Molecular Biology 2024Quote: ... TCEP (final concentration is 5 mM; Thermo Scientific) and Iodoacetamide (final concentration is 10mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% fetal bovine serum (FBS) (GIBCO, USA) and 1% PenStrep (GIBCO ...
-
bioRxiv - Neuroscience 2024Quote: ... claudin 5 (rabbit polyclonal, Invitrogen, #PA599415, 1:500) and the housekeeping protein calnexin (rabbit polyclonal antibody ...
-
bioRxiv - Neuroscience 2024Quote: ... total tau Tau-5 (Thermo Fisher Scientific, AHB0042). Anti-mouse IgG HRP-conjugated antibody (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% fetal bovine serum (Gibco, A3160502), 10 ng/mL bFGF (PeproTech ...
-
bioRxiv - Neuroscience 2024Quote: ... and DAPI (5 µg/µl; Invitrogen, Carlsbad, CA) in blocking buffer for 1–2 h at RT ...
-
bioRxiv - Biophysics 2024Quote: ... twenty four 5 ml culture tubes (Fisher Scientific, Catalog no ...
-
bioRxiv - Bioengineering 2024Quote: ... lipopolysaccharide was added (LPS, 5 μg/mL, Invitrogen) and to an M2 phenotype ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 ng/mL Human Recombinant EGF (Gibco) following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µL of 7AAD (Invitrogen, CAT#: A1310) were added to each sample and to the double positive tube ...
-
bioRxiv - Genetics 2024Quote: ... 400 µL acid phenol: chloroform 5: 1 (Ambion) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... filled with 5% agarose (Invitrogen, cat# 15517-014) dissolved in dH2O ...
-
bioRxiv - Neuroscience 2024Quote: ... with 5% KnockOut Serum replacement (Gibco, Cat # 10828028). hAstrocyte transwells were then moved to a new plate and treated with either vehicle (DMSO ...
-
bioRxiv - Microbiology 2024Quote: ... in Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific). The transcripts of either NbActin or CcActin were selected as an internal control to normalize the data ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was performed on lysates to amplify the genomic region targeted by the sgB with primers forward 5’GGGTGTTGTTCAGCGATGGA and reverse 5’ATAGATCTCATTGTGATCGA using Phusion High-Fidelity DNA polymerase (Thermo Scientific). The amplicons were cloned in pCR-bluntII-TOPO vector (Zero Blunt Topo PCR cloning kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) by colony PCR (Vaishnava et al., 2011) using DreamTaq Master Mix (ThermoFisher Scientific) and 0.2μM primers ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... using the oligonucleotides WPRE-F 5’-TGCTTCCCGTATGGCTTTCAT-3’ and WPRE-R 5’-CAGCAAACACAGTGCACACC-3’ as primers and SYBR Select Master Mix (ThermoFisher Scientific). The measurements were performed with a CFX384 instrument (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthetic EMCV RNA variants (Table 5) were dissolved in distilled water and labelled at the 5’ end with Dylight 650 maleimide conjugates (Thermo Scientific) using the 5′ EndTag kit (Vector Labs ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and diluted to 30 pg/μl concentration in 5 mM Tris-HCl (pH 7.5) supplemented with 5 ng/µl carrier herring sperm (Thermo Fisher Scientific). The MSI assay was performed using single-molecule PCR (SM-PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 µg of RNA was heated for 5 min to 65°C and cDNA was generated using SuperScript III (Life Technologies) and random primers for 1 h at 50°C followed by heat inactivation for 15 min at 70°C ...