Labshake search
Citations for Thermo Fisher :
2701 - 2750 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Synthetic Biology 2019Quote: ... × 5 mm 5 µm 100 Å and an Acclaim PepMap RSLC 75 µm × 25 cm 2 µm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Genomics 2020Quote: ... using forward primer (5’-TGATTATCGACATCCCGTCA-3’) and reverse primer (5’-GTCTGGAATCTCATAGGTAG-3’) and run on an ABI 7500 thermocycler (Applied Biosystems). Primer specificity and capture temperature were determined by melt curve analysis ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analysis of global levels of 5-mdC and 5-hmdC were performed on a Q exactive mass spectrometer (Thermo Fisher Scientific). It was equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended into 5 mL of warm PBS containing 5 μg mL−1 Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA, USA) to stain live leukocytes.
-
bioRxiv - Microbiology 2020Quote: Experiments to determine the sensitivity of the two RT-qPCR methods and nested PCR were completed using serial dilutions of each transcript (5*103 to 10−1 copies/5 µL) in a previously described RNA storage buffer containing RNA storage solution (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Resulting colonies were screened for plasmid presence by PCR of a portion of the pESC-URA-lpt1 plasmid (Forward primer: 5’-TTGGAAACAGCTCCAAATCC-3’, Reverse primer: 5’ CCCAAAACCTTCTCAAGCAA-3’; ordered from ThermoFisher Oligos) and preserved as glycerol stocks.
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... the Peptides were trapped for 10 min on a precolumn (Acclaim PepMap100, C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and subsequently separated using an analytical column (Easyspray 50 cm column (ES803 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 800 ng of digests were loaded in random order onto a pre-column (C18 PepMap 100, 5 µm, 100 A, 300 µm i.d. x 5 mm length, Thermo Fisher, 160454) at a flow rate of 50 µL/min with solvent C (0.05% TFA in water/acetonitrile 98:2).
-
bioRxiv - Neuroscience 2020Quote: ... then four times in PBS for 5 minutes (5 minutes for each wash) before mounting with Floromount G (Thermo Fisher Scientific). Slices were imaged an Olympus VS120 slide scanning microscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were retrotranscribed from either 5’-CATGCTGCTGGTGGGTGTGCT-3’ or 5’-CCATAAAGCACCGGTGAGCAGAA-3’ endoglin specific reverse oligonucleotides (500 nM) using RevertAid H minus reverse Transcriptase (Thermo Scientific) 10 U/μl in 1X RevertAid H minus Buffer supplemented with 2 U/μl RNAse OUT (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Embryos were then washed twice for 5 min each in PBS and subsequently incubated with 5 µg/ml Hoechst 33342 (Invitrogen, USA) in PBS for 5 min to stain the nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 x 107, or 5 x 107 PFU/mL (MOI of 5, 50, or 100 respectively) in CO2-independent medium (Gibco Life Technologies) supplemented with 0.1% (w/v ...
-
bioRxiv - Biophysics 2022Quote: ... and SN25 FL (1–206, R59C) or truncation mutant (11–206, R59C) were labeled with 5×molar excess Tetramethylrhodamine-5-maleimide (TMR) (Molecular Probes) in 25 mM HEPES pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were loaded onto a μ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 μm i.d.×5 mm, 5 μm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Neuroscience 2021Quote: The successfully reprogrammed hiPSCs were incubated in hypoxic conditions (5% CO2, 5% O2) at 37°C and maintained in StemFlex™ media (Gibco) on 6-well NUNC™ plates (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... using the ZIKV-F2 (5’-CAGCTGGCATCATGAAGAATC-3’) and ZIKV-R1 (5’-CACTTGTCCCATC TTCTTCTCC-3’) primers for African strain detection (ThermoFisher SCIENTIFIC) or the ZIKV-F1 (5’-CAGCTGGCATCATGAAGAACC-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... Acclaim™ PepMap™ 100 C18 LC Column (5 mm x 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) was used as trap column at a flow rate of 25 μL min-1 kept at 45 °C ...
-
bioRxiv - Physiology 2022Quote: ... washed once with cold acetone and then dissolved in Laemmli buffer (Tris 10 mM pH 7.5, EDTA 1 mM [Fluka, Buchs, Switzerland], β-mercaptoethanol 5%, SDS 5%, glycerol 10% [ThermoFisher Scientific]). Sonication and centrifugation were repeated as above to pellet and eliminate possibly remaining cell debris ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2022Quote: Hemolytic activity was assessed by spotting 5 μL of growing cells on Columbia agar plates supplemented with 5% defibrinated horse blood (Thermo Scientific), incubated for 24h at 37°C and analyzed for the presence of a lysis halo around the colony.
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences cutting near genomic loci of MLL3 Y4792 (5’-ACTATGGTCATCGAGTACAT-3’) and MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) were synthesized by Thermo Fisher’s custom in vitro transcription service ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membrane was washed 5 times 5 min in TBS-T prior to visualization with SuperSignal West Pico Chemiluminescent Substrate (Fisher Scientific) using the Azure c600 Gel Imaging System (Azure Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: Bladders of 5 young and 5 aged mice were collected and homogenized in TRIzol™ Reagent (15596026, Thermo Fisher Scientific, USA) to extract total RNA followed by DNase 1 treatment (18068-015 ...
-
bioRxiv - Molecular Biology 2019Quote: HeLa cells grown on poly-L-lysine–coated coverslips were incubated in 5% CO2 at 37°C for 1 h with 5 µM MitoTracker Red CMXRos (Molecular Probes) in DMEM ...
-
bioRxiv - Genetics 2019Quote: ... resuspended in 60 ml hypotonic lysis buffer (20 mM HEPES-KOH pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM PMSF and EDTA free protease inhibitor mixture from Roche and Thermo Scientific) and incubated for 15 min on ice ...
-
bioRxiv - Genetics 2019Quote: ... 20 mg/mL BSA (12 µl) and 5 Weiss U/µl T4 DNA ligase (5 µl in two instalments; Thermo Fisher) by incubating 4 h at 20°C with gentle rotation ...
-
bioRxiv - Cancer Biology 2019Quote: ... 97-mer oligonucleotides were purchased from Invitrogen and PCR amplified using the primers miRE-Xho-fw (5’ TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’) and miRE-EcoOligo-rev (5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’) according to Phusion High-Fidelity kit (Thermo Scientific). The PCR product (139 bp ...
-
bioRxiv - Pathology 2021Quote: ... Each paraffin-embedded tissue was sequentially sectioned at 5 μm thickness into 5 consecutive sections and were mounted on HistoGrip (Invitrogen, US) coated glass slides ...
-
bioRxiv - Plant Biology 2021Quote: The IKU2 promoter was amplified using the primers Prom-IKU2-B4 (5’-ggggacaactttgtatagaaaagttgGGTCTCTCTTGATAACGATTTG-3’) and Prom-IKU2-B1R (5’-ggggactgcttttttgtacaaacttgTGTTCTCTACGTCGGAAGG- 3’) and cloned into pDONR-P4-P1R (Life Technologies). A triple LR Gateway reaction (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was done on1 uL of cDNA using 10 µM of forward and reverse primers (Fw 5’-AAGATTCTCCTGAGCTGGGTC −3’ and Rv 5’-AGTCACTTTAGGTGGCCTTGG −3’, Life technologies) and 1 U Taq DNA polymerase (10342 ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted from each neural tube (5 samples per condition (EPAS1 and 5’-mispair, respectively)) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... or equimolar mix of two human APOBEC3A siRNAs (Silencer 45715 and 45810, respectively, with sense sequences 5’-GACCUACCUGUGCUACGAATT-3’ and 5’-GCAGUAUGCUCCCGAUCAATT-3’, Life Technologies) using Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Dried fractions were resuspended in 8 μL 5% ACN + 5% FA and analyzed on an Orbitrap Fusion with in-line Easy Nano-LC 1000 (Thermo Scientific). Fractions were run as 3 h gradients progressing from 3% ACN + 0.125% FA to 100% ACN + 0.125% FA ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequently a copy of chromosome XV was removed by counter-selection against the URA3 gene by replica-plating on SD medium containing 1 mg/mL 5-fluoroorotic acid (5-FOA, ThermoFisher Scientific) from a 100 mg/mL stock in DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... or with a pool of two different USP30 siRNAs (D1: 5’-CAAAUUACCTGCCGCACAA-3’; D3, 5’-ACAGGAUGCUCACGAAUUA-3’, Dharmacon; siUSP30) by using Lipofectamine RNAiMAX (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... and human Oct 4 (For: 5’-CTTGCTGCAGAAGTGGGTGGAGGAA-3’/Rev: 5’-CTGCAGTGTGGGTTTCGGGCA-3’) PCRs were conducted using an ABI 7300 Real Time PCR System (Applied Biosystems). PCR cycling conditions were 95° C for 10 min. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Immunology 2021Quote: ... against the IAV nucleoprotein (forward: 5’-CAGCCTAATCAGACCAAATG-3’; reverse: 5’-TACCTGCTTCTCAGTTCAAG-3’) were assayed using SYBR Green Master Mix (Applied Biosystems) to confirm viral presence in the maternal lung.
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Genetics 2020Quote: ... mouse cDNA was amplified with primers (F: 5-gtttatgggcctcaacctcatg-3, R: 5-caggcttcactccagctttttgg-3) and then enzyme digested with BsiEI (Thermofisher #FD0894). Genotyping result using this method is shown in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... counted with a haemocytometer to a concentration of 5 × 10^5 cells/mL and seeded into 96-well microplate (Nunc, Thermo Scientific).
-
bioRxiv - Microbiology 2022Quote: ... The barcode region was amplified from the isolated DNA using forward (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCATCATGAACAATAAAACT GTCTGC3’) and reverse (5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGA CGATGACGGGCTGGTC3’) primers using Phusion high fidelity polymerase (ThermoFisher Scientific) for 20 cycles ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Physiology 2024Quote: Coarsely chopped liver fragments from each mouse were digested in 5 ml liberase-based digestion mix (5 ml of DMEM [Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... first onto an Acclaim PepMap100 C18 LC Column (5 mm Å∼ 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 μL min−1 maintained at 45 °C and then then separated on 50 cm RP-C18 µPAC™ column (PharmaFluidics) ...