Labshake search
Citations for Thermo Fisher :
2451 - 2500 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... with CellROX Deep Red (ThermoFisher C10422, 5 μM) and MitoTracker Red (Invitrogen M7512 ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl of lipofectamine 3000 (Thermo Scientific, #L3000015) was mixed with 120 μl of opti-MEM and mixed thoroughly ...
-
bioRxiv - Genetics 2024Quote: ... 5 mL 10x PBS (Ambion AM962, pH 7.4), and 40 mL nuclease-free water (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... on a QuantStudio 5 RT-PCR (Applied Biosystems). Relative gene expression values were calculated using the delta-delta Ct method ...
-
bioRxiv - Immunology 2024Quote: ... 5 % CO2 incubator with protein transport inhibitor (Invitrogen) added in the last 4 hours ...
-
bioRxiv - Immunology 2024Quote: ... 5 μM CellROX Deep Red (ThermoFisher Scientific; C10491), or 100 nM MitoTracker Green FM (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 µg/mL (7.5 µM) PI (Invitrogen) and incubated for 5 minutes prior to imaging with a Zeiss Axio Observer 5 fluorescent microscope ...
-
bioRxiv - Immunology 2023Quote: ... After incubation with 5 μM CM-H2DCFDA (Invitrogen) at 37°C for 30[min in culture media without FBS and recovery in a complete media for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of GlycoBlue co-precipitant (Invitrogen, AM9516), and 320 µL of ethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... medium supplemented with 5% fetal bovine serum (Gibco), 5 μg/ml Bovine insulin (Cell Applications) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL 0.04-µm fluorescent microspheres (F8789, Invitrogen), 0.75 µL TEMED (Fisher Bioregents ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-diphenyltetrazolium bromide] (Life Technologies, Burlington, ON, Canada) in PBS solution ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µL/well using a Multidrop Combi (ThermoFisher). 50 nL of compounds in DMSO was added to target wells using an acoustic liquid handler (Labcyte Echo 500) ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction was quenched with 5% hydroxylamine (ThermoFisher) and samples combined in equal ratios as determined by running 1 μl of each sample combined on an orbitrap instrument ...
-
bioRxiv - Neuroscience 2024Quote: ... β-Tubulin (1:5 000, MA5-16308, Thermo Fisher) PINK1 (1:1 000 ...
-
bioRxiv - Cell Biology 2024Quote: ... with Laminin521 coating (5 μg/ml; Gibco A29248). Once the cells became approximately 70% confluent ...
-
bioRxiv - Developmental Biology 2024Quote: ... and QuantStudio® 5 System (Applied Biosystems, USA). Equimolar pooling of libraries was performed based on QC values ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.06% blasticidin (5 mg/ml, Invitrogen, #R210-01), and 0.125% zeocin (100 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl SYBR Select Master Mix (Life Technologies), 0.2 μl forward primers (5 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 µL Control Rabbit IgG (Invitrogen, 10500C), then incubated with end-over-end rotation at 4 °C overnight ...
-
bioRxiv - Pathology 2023Quote: ... 5 mg/ml endothelial cell growth factor (Gibco), and antibiotics on culture plates pre-covered with 0.5% gelatin and 100mg/ml collagen type I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% horse serum (Thermo Fisher Scientific), 20 ng/mL EGF (Pepro Tech) ...
-
bioRxiv - Neuroscience 2024Quote: ... fluororuby (5% in sterile saline; catalog: D1817, ThermoFisher) was entirely the same ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 mM sodium pyruvate (Gibco, cat#11360), shaking at 300 RPM at 25°C ...
-
bioRxiv - Neuroscience 2024Quote: ... A QuantStudio 5 Real-Time PCR System (ThermoFisher) was used to perform the qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 1x 5 minutes with Tris-buffered saline (Invitrogen), and finally 1x 5 minutes with Tris-glycine buffer (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% Normal Goat Serum (50-062Z; ThermoFisher Scientific), 0.3% Triton X-100 (9036-19-5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 µg/ml monoclonal CD11c (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 μg/ml laminin (Thermo Fisher Scientific)- coated plates in NPC media ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 5 g of HP20 resins (Thermo Fisher) was added to the reaction mixture to absorb the desired product ...
-
bioRxiv - Cell Biology 2024Quote: ... consisting of 5 μL of RNAiMax (ThermoFisher Scientific) and 2.5 pmol of the specified siRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 5% CO2 in DMEM (Gibco cat# 11965-092) supplemented with 10% FCS (HyClone cat# SH30073.03) ...
-
Tuning non-linear mechanics in collagen hydrogels modulates cellular morphotypes in three dimensionsbioRxiv - Biophysics 2024Quote: ... 5 mL Penicillin-Streptomycin (10,000 U/mL; Gibco), and 5 mL Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Plant Biology 2023Quote: ... or Alexa Fluor 488-5-dUTP (Life Technologies) by nick-translation ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5 µM Alexa Fluor 647 Azide (Invitrogen) were performed for 30 minutes at room temperature while protected from light ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ng/ml epidermal growth factor (Gibco BRL), 0.2 μMg/ml dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5 ml of PRMI 1640 (Thermo Scientific) with 10 % FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% (v/v) heat-inactivated FBS (Life Technologies), 1% (v/v ...
-
bioRxiv - Bioengineering 2024Quote: ... at 37°C and 5% CO2 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 5% foetal bovine serum (FBS) (Gibco) and streptomycin/penicillin (100 U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution of 5 mg AcX (A20700, Invitrogen), dissolved in freshly opened 500 μl anhydrous DMSO (D12345 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested with 5 μl RNAseI (Ambion, cat # AM2295) for 30 min at 24 °C with mild shaking (300 rpm ...
-
bioRxiv - Immunology 2023Quote: ... or 5 µg/ml anti-CD3 (OKT3, ThermoFisher) and anti-CD28 (CD28.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was performed on lysates to amplify the genomic region targeted by the sgB with primers forward 5’GGGTGTTGTTCAGCGATGGA and reverse 5’ATAGATCTCATTGTGATCGA using Phusion High-Fidelity DNA polymerase (Thermo Scientific). The amplicons were cloned in pCR-bluntII-TOPO vector (Zero Blunt Topo PCR cloning kit ...