Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... with unlabeled forward (5’-CTTGTCTGTAAGCGGATGCC) and reverse (5’-ACGCAAACCGCCTCTCC) primers and purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the templates contained the T7A1 promoter with a transcription start site 128 bp ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 x 107, or 5 x 107 PFU/mL (MOI of 5, 50, or 100 respectively) in CO2-independent medium (Gibco Life Technologies) supplemented with 0.1% (w/v ...
-
bioRxiv - Genetics 2022Quote: ... 5’-GGCAAGCUGACCCUGAAGUdTdT-3’ / 5’-ACUUCAGGGUCAGCUUGCCdTdT-3’ or with a hsa-miR-34a mimic duplex: 5’-P-UGGCAGUGUCUUAGCUGGUUGUU-3’ / 5’-P-CAAUCAGCAAGUAUACUGCCCUA-3’ according to the protocol for Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... a fragment containing 2.21 kb upstream regulatory region of ELF3 was amplified from Col-0 genomic DNA using primers ELF3Prom-Fw (5’-CACCCTTATAAATAAAATTCC-3’) ELF3Prom-Rv (5’-CACTCACAATTCACAACCTTTTTC-3’) and cloned into the Gateway System (pENTR™ Directional TOPO® Cloning kit, Invitrogen) to obtain the pELF3-TOPO plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA sequences targeting CD33 exon 2 were 5’-TCCATAGCCAGGGCCCCTGT and 5’-GCATGTGACAGGTGAGGCAC.25 U937 cells were washed three times in PBS (Gibco 10010-023) and resuspended in complete Nucleofector Kit C (Lonza Biosciences VCA-1004 ...
-
bioRxiv - Microbiology 2019Quote: ... Strains were routinely grown at 37°C and 5% CO2 overnight on tryptic soy agar plates supplemented with 5% sheep blood (TSAII) (Thermo Fisher Scientific). Growth in broth culture was performed in BHI (Becton ...
-
bioRxiv - Cell Biology 2019Quote: Cultured mCSCs and mBMSCs were suspended at 5 × 10^5 cells/mL in PBS and 200uL was loaded into EZ Cytofunnels (ThermoFisher, Carlsbad, CA) within a Shandon Cytospin 4 (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: We cotransfected 10-12 replicates of HCT-116 cells with 5 µg of PB-SRT-Puro plasmid and 5 µg PBase plasmid via Neon electroporation (Thermo Fisher #MPK10025). Each replicate contained 2×106 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... the gel bands were incubated in 150 μL of 100% ACN for 5 minutes at RT and dried for 5 minutes in a SpeedVac Vacuum Concentrator (Thermo Fisher Scientific). Ingel digestion was performed overnight in 50 μL reactions containing 12.5 ng/μL trypsin in 50 mM TEAB at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: The transcription start site of AhLEC1A gene was identified by 5’ RACE (rapid amplification of cDNA ends) using a 5’ RACE kit (Invitrogen GeneRacerTM Kit) following the instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... After 5 h incubation at 37°C with 5% CO2 cell were washed twice with PBS containing proteases inhibitors (Thermo Fisher Scientific), spun down at 1000 g for 5 min at 4°C and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The negative controls of our RT-PCR reactions were formed from the same reaction mix as our samples switching only the 5 uL of DNA by 5 uL of ultrapure™ DNase/RNase-Free Distilled Water (Invitrogen France), thus one negative control is placed after every 5 samples on a Light cycler 480 multiwell plates 96-well plate (Roche).
-
bioRxiv - Microbiology 2020Quote: ... and hyphae were washed three times with PBS (pH 7.4) and then incubated in 5 mL of PBS containing 5 mg EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific, 21335) for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... (5’-CUAUGAACAUAAAGUCUGCTT-3’) or its non-specific control (5’-UUCUCCGAACGUGUCACGUTT-3’) were transfected into cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with protease inhibitors (1 mM PMSF, 5 μg/ml aprotinin and 5 μg/ml leupeptin, #78443, Thermo Fisher Scientific, Waltham, MA). Fifty ul of Dynabeads Protein A/Protein G (#10015D ...
-
bioRxiv - Microbiology 2019Quote: ... free bacteria were washed off and the infected cells were resuspended in Hl5c containing 5 U/mL of penicillin and 5 μg/ml streptomycin (Thermo Fisher Scientific). The time of addition of bacteria to the adherent cells is referred to as 0 hours post infection (hpi) ...
-
bioRxiv - Neuroscience 2021Quote: ... Drosophila dSF2 sequence was PCR amplified (dSF2 F 5’-CACCATGGGATCACGCAACGAGTGCCG-3’ and dSF2 R 5’- ATAGTTAGAACGTGAGCGAGACCTGG-3’) was cloned into pEntry-TOPO vector (Thermo Fisher Scientific). The pENTR-dSF2 vector was recombined with Gateway plasmid pTWH (Drosophila Genomics Resource Center ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded onto an Acclaim PepMap 100 C18 trapping column (300 μm i.d. × 5 mm length, 5 μm particle size, 100 Å pore size; Thermo Fisher Scientific) from the UltiMate 3000 autosampler with 0.1% aqueous formic acid for 3 minutes at a flow rate of 10 μL/min ...
-
bioRxiv - Neuroscience 2022Quote: ... The peptides were loaded on a reverse-phase PepMap 100 C18 μ-precolumn (5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Fisher) and then resolved on a nanoscale PepMap 100 C18 nanoLC column (3 μm ...
-
bioRxiv - Microbiology 2022Quote: ... counted with a haemocytometer to a concentration of 5 × 10^5 cells/mL and seeded into 96-well microplate (Nunc, Thermo Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2022Quote: ... Peptides were first trapped on a C18 precolumn (Acclaim PepMap 100, 300 μm × 5 mm, 5 μm, 100 Å) (Thermo Fisher Scientific) and eluted peptides were subsequently separated on a μPAC 50 column (PharmaFluidics ...
-
bioRxiv - Cell Biology 2022Quote: ... and resuspended in 5% formic acid and 5% acetonitrile for analysis by LC/MS-MS on an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific) coupled to a Proxeon EASY-nLC II liquid chromatography (LC ...
-
bioRxiv - Cell Biology 2022Quote: ... using primary antibodies diluted in blocking solution (VE-Cadherin, #14-1441-82, 5 μg/ml final and HES1, #PA5-28802, 5 μg/ml final, Thermo Fisher Scientific) for 48h at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Physiology 2022Quote: ... The ventricles were dissected into 3-mm2 columns and shaken at 800 rpm for 90–120 min at 30°C with 750 µL digestion buffer (12.5 µM CaCl2, 5 mg/mL collagenase type II [Thermo Fisher Scientific Inc., Waltham, MA, USA], 5 mg/mL collagenase type IV [Thermo Fisher Scientific Inc.] ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubating at 37°C in a 5% CO2 humidified incubator in DFGM supplemented with 5 ng mL−1 TGF-β1 (Thermo Fisher Scientific) and 100 μg mL−1 ascorbic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... the samples were spun down at 300g for 5 min at room temperature and resuspended in 5 mL of NeuroBasal-A medium (Gibco, 10888-022) with 1% penicillin-streptomycin-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... The ΔK280 deletion was introduced into the expression plasmids by site-directed mutagenesis using phosphorylated primers (5’AAGCTGGATCTTAGCAACGTC and 5’ATTAATTATCTGCACCTTCCCGCC) with Platinum SuperFi DNA Polymerase (ThermoFisher Scientific, USA). The phosphoblocking tau mutant (Tau352Ala ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Cell Biology 2024Quote: ... For SNX5 and SNX6 the following siRNA sequences were used: SNX5 (5′-UUAGUUUCAGCCCGAAGCAUC-3’), SNX6 (5′-UUAUGAGGUAGACGACUAAAU-3’) (Wassmer et al., 2007), VPS35 (ID 132357, AM16708) (Predesigned – Thermo Fisher Scientific). Nontargeting control siRNA (control ...
-
bioRxiv - Cell Biology 2023Quote: ... Approximately 1 μg of the sample was loaded onto a micro-precolumn (C18 PepMap 100, 300 μm i.d. × 5 mm, 5 μm particle size, 100 Å pore size, Thermo Fisher Scientific) with the sample loading solution for 3 min ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM EDTA, 5 mM DTT, 10 mM β-mercaptoethanol, 1% SDS, 1 mM PMSF, and 1X protease inhibitors from Thermo Fisher), and the plant debris was removed by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... each culture was diluted 1:1000 in BHI + 5% yeast and 10μl were streaked on a BHI + 5% yeast agar (Thermo Fisher Scientific, CM1136) plate ...
-
bioRxiv - Neuroscience 2024Quote: ... Nine volumes of brain homogenate were mixed with one volume of 10X detergent buffer [5% (w/v) sodium deoxycholate and 5% (v/v) Nonidet P-40 in PBS] containing Pierce Universal Nuclease (ThermoFisher Scientific #88701) and Halt Phosphatase Inhibitor (ThermoFisher Scientific #78420) ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Genomics 2024Quote: Human dermal fibroblasts (ATCC PCS-201-010) were maintained at 37°C with 5% CO2 and 5% O2 using low glucose DMEM (ThermoFisher 11885-084) enriched with 15% FBS (GenClone 25-550 ...
-
bioRxiv - Immunology 2024Quote: Analysis of cytokines and chemokines from sera and lungs homogenates collected 5 dpi and 5 dpc were conducted using the ProcartaPlex TM Mouse Cytokine & Chemokine Convenience Panel 1 26-plex (Thermo Fisher Scientific) following the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were loaded onto an RP C18 pre-column (Acclaim PepMap, 300 μm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) and washed with 0.1% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of peptides solution was injected and concentrated on a µ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 mm, 100 A°, Thermo Fisher Scientific) at a flow rate of 10 mL/min and using solvent containing H2O/ACN/TFA 98%/2%/0.1% ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were again washed 3x with 1 mL DPBS for 5 min each followed by nuclear labeling for 5 min with 1 mL 300 nM DAPI dissolved in DPBS (Thermo Fisher Scientific) and a 5-min DPBS wash ...
-
bioRxiv - Developmental Biology 2023Quote: ... Extended culture up to day 10 was obtained upon extracellular matrix supplementation in IVC2 media starting from 5 dpa with 5% Geltrex (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was then washed in PBS (5 x 5 min) and placed into a DAPI stain solution (300 nM in PBS, D3571, RRID: AB_2307445; ThermoFisher Scientific, Portsmouth, NH) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed four more times in 0.1 M PBS with 0.5% Triton X-100 for 5-10 minutes and then mounted on glass slides using Fluoromount-G with DAPI (Thermo Fisher Scientific). Individual sections were imaged using a slide scanner (Olympus ...
-
bioRxiv - Cell Biology 2023Quote: ... All drug treatments were performed for 3 – 5 hours prior to imaging with a final concentration of 5 nM of actinomycin D (Gibco, 11805-017) or 1 µM of BMH-21 (Sigma-Aldrich ...