Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... the gels were washed with wash buffer three times for 5 min followed by permeabilization and blocking in 5% goat serum (Gibco), 1% BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR™ Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 200 nM each of forward and reverse primer for AXIN2 (Fwd ...
-
bioRxiv - Biochemistry 2024Quote: Enriched crosslinked peptides were injected onto a C18 PepMap100-trapping column (0.3 x 5 mm, 5 μm, Thermo Scientific™) connected to an in-house packed C18 analytical column (75 μm x 300 mm ...
-
bioRxiv - Biochemistry 2024Quote: The tryptic peptides were injected onto a pre-column (PepMap C18, 5 mm × 300 μm × 5 μm, Thermo Fisher Scientific) and separated ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Microbiology 2024Quote: ... the cell suspension of infected amoebae was detached from the culture dish and resuspended in HL5-C with 5 U/mL penicillin and 5 μg/mL of streptomycin (Gibco) to inhibit extracellular growth of bacteria ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl of 5 mg/ml glycogen (Ambion), and 1 ml of cold isopropanol ...
-
bioRxiv - Biophysics 2021Quote: ... wash with 5 mL DPBS (Thermofisher, cat. # 14190144) and aspirate ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 5% fetal calf serum (Gibco #16030074) and 200 nM 12-Otetradecanoyl phorbol-13-acetate (Sigma #16561-29-8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and blocking with 5× Denhardt’s solution (Thermo Scientific) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... was supplemented with 5% Horse Serum (Life Technologies), 10ug/ml Insuline ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µl of fluorescent microbeads (FluoSpheres; Molecular Probes) were incubated with 0.1 mg/ml PLL-PEG on a rotator for 1 h at 4°C prior to mixing with the gel mixture ...
-
bioRxiv - Genetics 2021Quote: ... and 5% heat-inactivated FBS (Thermo Fisher Scientific). All cells were cultured at 25°C and were free from mycoplasma contamination.
-
bioRxiv - Genomics 2021Quote: ... containing 10% FBS and 5% pen/strep (ThermoFisher). Cells were counted with a hemocytometer and Seq-Well S3 was performed as described below43 ...
-
bioRxiv - Cell Biology 2020Quote: ... Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 μM MitoSOX Red (MR; Thermofisher; detects superoxide), or 0.1 mM dihydrorhodamine 123 (DHR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL of 10X T4 Ligase Buffer (ThermoFisher), 2.5 μL of T4 Ligase (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... + 5 μg/mL Blasticidin (ThermoFisher, catalog number A1113903). For treatment experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 5% fetal calf serum (FCS; Gibco), 5% human serum AB (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: 5 mg of Amplex Red (AR; Invitrogen A12222) was dissolved in 0.9725 mL neet DMSO to yield a 20 mM solution ...
-
bioRxiv - Neuroscience 2021Quote: ... and loaded with 5 µM coelenterazine h (Invitrogen) for 4 hours at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... EdU (5-ethynyl-2’-deoxyuridine, Invitrogen, cat# A10044) was dissolved in PBS at 0.5 µg/µl and injected intraperitoneally into mice at 5 µg/g body weight 24 h before harvesting ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 μl of EdU (10mg/ml, Thermo Scientific) was directly pipetted on top of the explants and then incubated for 4 hours before processing tissues for frozen sections ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-paxillin (Invitrogen, Cat. AHO0492, 1:5), mouse-anti-NCAM1 (DSHB ...
-
bioRxiv - Immunology 2021Quote: ... 5% KnockOut™ serum replacement (All Thermo Fisher), 0.5% human serum albumin (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... nanoparticles were resuspended in 5% pluronic F127 (ThermoFisher) and incubated 20min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... CD4 (RM4-5, Thermo Fisher Scientific, Waltham, MA), CD3 (145-2C11 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mMand 33 mM D-glucose (Gibco, USA) were added to the medium for 48 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5% CO2 in RPMI 1640 Glutamax medium (Gibco) supplemented with 10% heat-inactivated Fetal Bovine Serum (Biowest) ...
-
bioRxiv - Cell Biology 2019Quote: ... reduced with 5 mM dithiothreitol (Thermo Fisher Scientific), and alkylated with 40 mM iodoacetamide (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5% charcoal stripped FBS (#12329782, Thermo Fisher Scientific) and 1% penicillin-streptomycin (50 U/mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... and DNAse I (5 units/ml, ThermoFisher Scientific) was used to obtain soluble fractions (SF ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 µL of Alamar blue dye (Invitrogen, DAL1100) was added to each well ...
-
bioRxiv - Immunology 2020Quote: ... 5 μ M HEPES (both from GIBCO/ Invitrogen), and 10% FCS (Biosera ...
-
bioRxiv - Immunology 2020Quote: ... 5 μ M HEPES (both from GIBCO/ Invitrogen), and 10% FCS (Biosera ...
-
bioRxiv - Microbiology 2019Quote: ... SAB agar plates (5-cm plates, Fisher Scientific) inoculated with 200 μL of a M ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.5 μl of 5 mM DRAQ5 (ThermoFisher #62251) were added.
-
bioRxiv - Synthetic Biology 2020Quote: ... SapI (LguI) at 5 U/µL (Thermo Fisher): 12.5 nl ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and C16:0-Bodipy (5 µM, Thermo Fisher) and Mitotracker Orange CMTMRos (0.4 µM ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5-ethynyl-2’deoxyuridine (EdU; Thermo Fisher Scientific) or 5-Bromo-2’deoxyuridine (BrdU ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100mM NaCl(Fisher Scientific, CAS# 7467-14-5), 25mM Tris (Amresco ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 μl 5-10 nM (TMR)-phalloidin (Invitrogen)-labeled bovine actin and incubated for 3 min ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 5% fetal bovine serum (Life Technologies), 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 ml of Opti-MEM (Gibco 11058021) was added to the plate ...
-
bioRxiv - Immunology 2021Quote: ... cells were labeled with CTV (5 μM, Invitrogen) to trace cell proliferation before transfer.
-
bioRxiv - Genomics 2021Quote: 5 μl of protein A Dynabeads (10001D, Invitrogen) were used in each MOWChIP assay ...
-
bioRxiv - Cell Biology 2020Quote: ... or 5 μM MitoSOX (Life Technologies, M-36008) in recording media (125 mM NaCl ...