Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 2 4 Difluoro N 2 methoxy 5 4 4 morpholinyl 6 quinazolinyl 3 pyridinyl benzenesulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 × 105 cells were seeded in 6-well plates and cultured with RPMI 1640 medium (ThermoFisher # 11875093) containing 10% FBS (Seradigm) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines were passaged every 4-6 days and MIN6 were detached with 0.25% trypsin-EDTA (Gibco) and seeded at 7.5-1×106 cells per 75 cm2 flask ...
-
bioRxiv - Cell Biology 2022Quote: ... Organoids were passaged every 4 to 6 days by dispersion with TrypLE Express (Invitrogen, Carlsbad, CA, USA) and re-embedded in Matrigel-GFR.
-
bioRxiv - Bioengineering 2024Quote: ... This was followed by foregut cell differentiation from day 4 - 6 using advanced DMEM/F12 (Gibco; 12634) with 2% B27 (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2mM DTT) for 30 min at 4 °C and analyzed on 6% TBE gels (Life Technologies) at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA samples were then treated with 4-6 units of Turbo DNase (Thermo Fisher Scientific, cat# AM2238) at 37 °C for 30 min to remove the bulk of plasmid DNA contamination ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Microbiology 2021Quote: ... 2% fetal bovine serum (S182H-500, Eurobio) and N-2 Supplement (17502048, Thermo Fisher) at 37°C and 5% CO2.
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 mM L-glutamine (2 mM, Gibco #31600-091 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-di-amidino-2-phenylindole (DAPI; Invitrogen) on a glass slide ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) from ThermoFisher; anti-mouse IgG-horse radish peroxidase (HRP) ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1/10,000 for nuclei staining ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (ThermoFisher, #D1306) at a concentration of 10 µg/ml in PBS / 3.0%BSA for 15 minutes then rinsed 3x 5 minutes in distilled water ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1:10000 in PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) to visualize nuclear DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... grown to confluence and incubated with the calcium indicator Fluo 4-AM (Fluo-4 Direct assay kit, Invitrogen) for 60 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... external cysteine residues were blocked with 107 μM 4-acetamino-4’-maleimidylstilbene-2,2’-disulfonic acid (AMS, Thermo Scientific) for 20 min on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4) for 10mins and later incubated with 4 uM fluo-4/AM (1 mM, Molecular probes, #F14201) and 0.002% pluronic F-127 (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... or separating the pooled samples on a 4% agarose gel (E-Gel® EX Agarose Gels, 4%, Invitrogen), and gel purification of fragments larger than adapter dimers (>150bp) ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain halves were either drop-fixed in phosphate buffered 4% paraformaldehyde 4°C (Thermo Fisher Scientific, Waltham, MA) for 24 hours at for immunohistochemical staining or micro-dissected (cortex ...
-
bioRxiv - Immunology 2024Quote: ... The tissues were fixed overnight at 4 °C in 4% methanol-free paraformaldehyde (ThermoFisher Scientific, cat no. U01H501), and then washed three times with 1xPBS for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of 100 μl of sample was loaded onto 4-12% Novex Tris-glycine gel (Invitrogen, XP04120BOX). Western blotting was done using an anti-FLAG antibody ...
-
bioRxiv - Bioengineering 2023Quote: ... Fluo-4 reagent solution (prepared according to manufacturer’s instructions; Fluo-4 Direct Calcium-Assay-Kit, Thermo Fisher Scientific) was added to culture medium (50% of culture medium volume ...
-
bioRxiv - Neuroscience 2023Quote: ... heated for 2min at 85C and loaded on a TrisGlycine 4-20% SDS-PAGE gel (4-20%, Invitrogen) along with a PrecisionPlus Kaleidoscope protein ladder (BioRad 1610375) ...
-
bioRxiv - Neuroscience 2024Quote: ... for 4 hr at 4°C followed by 30 min counterstain with Hoechst 33342 (1:5000, Invitrogen, H3570). Following 3 x 10 min washes in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... After fixing for 1h at 4°C in 4% PFA (prepared in PBS; Thermo Fisher Scientific, catalog 043368.9M), embryos were rinsed with PBS and then cryoprotected in 30% sucrose in 0.1M phosphate buffer overnight at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Gastruloids were subsequently fixed in 10 ml 4% paraformalde-hyde solution (PFA, Thermo Scientific Chemicals, 30525-89-4) for 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... with IonPac 4 x 250 mm IonPac AS4A and 4 x 50 mm AG4A guard columns (Thermo Scientific). Samples were eluted at 24 °C with 0.1 M NaOH (isocratic ...
-
bioRxiv - Genetics 2021Quote: ... at 85 V for 2 hours 15 minutes at an ambient temperature of 4 °C in NuPAGE™ Transfer Buffer (Invitrogen, UK) containing 10% 2-propanol (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 µl of either type of samples were run on BOLT 4-12% Bis-Tris mini protein gels for SDS-PAGE and electroblotted using the iBlot 2 dry blotting system (Thermo Fisher, USA). Polyvinylidene fluoride membranes were probed with anti-PrP monoclonal antibody ICSM-18 (1:4,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryo hippocampi were dissected in 4 °C Hibernate E supplemented with 2% B27 supplements and 100 U/mL Penicillin/Strep (Thermo Fisher Scientific). Hippocampal tissues were digested in Hibernate E containing 20 U/mL papain ...
-
bioRxiv - Neuroscience 2021Quote: ... hMOs were then washed overnight with 1X PBS at 4°C and incubated with Hoechst 33342 solution in 1X PBS for 2 h (1:1000, Thermo Fisher Scientific) and washed in PBS for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Grids were then blotted with filter paper for 2 s at 100 % humidity at 4 °C and frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... formic acid and the peptides equivalent to 2-4 µg of proteins were loaded for mass spectrometry analysis on a Orbitrap Elite mass spectrometer (ThermoFisher Scientific Inc.). The separation of peptides was performed on an analytical column (75 µm × 15 cm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ten-microliter sample were loaded at a 0.45 mL/minute flowrate onto an anion separator (2 × 250 mm, 4 μm, AS19, Thermo Scientific, Bremen, Germany) with a 50 mm guard with the same separator material ...
-
bioRxiv - Microbiology 2020Quote: ... Two hundred microliters of 2 μM calcein AM/4 μM ethidium homodimer-1 in PBS (Live/Dead® Viability Kit, Invitrogen, USA) were added to the wells and plates incubated for 30 min in the dark ...
-
bioRxiv - Cancer Biology 2020Quote: 10 ul whole cell extracts of 2 × 105 cells in 40 μl 6X SDS loading buffer were run on 4-14% bis-tris gel (Invitrogen cat # NP0335). Membranes were transferred by semi-dry apparatus (Bio-Rad Transblot cat # 170-3940 ...
-
bioRxiv - Biophysics 2020Quote: ... The grids were blotted for 4 s or 2 s and rapidly cryocooled in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific) at 4°C and 100% humidity ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were loaded with the Ca2+ indicator Fluo-4/AM (for intracellular Ca2+) or Rhod-2/AM (for mitochondrial Ca2+) (Thermo Fisher Scientific) for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: HEK293T cells plated at a density of 80,000-90,000 cells.cm-2 on a pre-coated PDL 4-well Nunc™ Lab-Tek™ II chamber (Thermo Fisher Scientific, #155382PK) were co-transfected with PylRS/4xtRNAPyl (500 ng ...
-
bioRxiv - Molecular Biology 2022Quote: The ubiquitylated worm CMG was then incubated for 30 minutes at 4°C with 2 µl (per 10 µl ubiquitylation reaction mix) magnetic beads (Dynabeads M-270 Epoxy; Life Technologies, 14302D) that had been coupled to anti-worm SLD-5 antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... They were stained for 2 days at 4°C with a mouse-derived antibody against GFP (1:400, mAB 3E6, Invitrogen, Darmstadt, Germany), washed for 2 hours at RT in 1x PBS ...