Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 10000+ citations for 2 4 Difluoro N 2 methoxy 5 4 4 morpholinyl 6 quinazolinyl 3 pyridinyl benzenesulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Biochemistry 2024Quote: ... Half of the culture medium was refreshed every 3-4 days with DMEM (Gibco, USA) supplemented with 10% FBS (CellMAX ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) and resolved (~80 μg/lane) in a linear 3-12% acrylamide gradient (Invitrogen). For BN-PAGE ...
-
bioRxiv - Biophysics 2024Quote: ... The Ca2+-sensitive dyes Fluo-4 AM (Dojindo) and Rhod-3 AM (Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cancer Biology 2021Quote: ... CD44 and CD62L and then incubated with 5 μM Fluo-4 AM (Molecular Probes) for 15 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: SMN cultures were incubated at 37°C with 5 μM Fluo-4 AM (Invitrogen) for 30 min in Neurobasal A medium (no supplements) ...
-
bioRxiv - Neuroscience 2020Quote: ... then 5 μg were loaded and separated on 4–12% NuPage acrylamide gels (Invitrogen) with NuPage MOPS running buffer for 2 h at 110 V ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates containing around 5 × 106 cells were separated on 4-20% polyacrylamide gels (Invitrogen) in running buffer (25 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... the premixed solution containing 4 µl of 5×RT buffer (Invitrogen, Cat no. #18080044), 2µl of 0.1 M DTT (kit component of Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in group of 5 per well using 4-well plates (ThermoFisher). Lumens of individual HIOs were microinjected with glass caliber needles with 1 μl of PBS or different strains of Salmonella (105 CFU/HIO or 103 CFU/HIO for 24h time point experiments) ...
-
bioRxiv - Immunology 2021Quote: ... 94°C 5 min) with 4 μl of RNA and random hexamers (Thermofisher scientific). A PCR was further performed based on the protocol established by Tiller et al (Tiller et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... were passaged every 4-5 days using Stem-Accutase (Cat# A11105-01, Life Technologies) in the presence of 1 µM Thiazovivin (THZ Cat# SML1045-25 MG ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-TLR-4 polyclonal antibody (5 µg/ml, PA5-23124, Thermo Fisher Scientific), and rabbit anti-TLR-5 polyclonal antibody (10 µg/ml ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections of 4-5 µm were cut using a rotary microtome (HM355S, Thermo Scientific). Sections were deparaffinized in xylene and rehydrated in a descending series of ethanol (96%–50% ...
-
bioRxiv - Microbiology 2024Quote: ... After 4–5 days of culture in the Expi293 Expression Medium (Thermo Fisher Scientific), supernatants were collected and passed through a 0.22-µm filter ...
-
bioRxiv - Physiology 2024Quote: ... Intracellular Ca2+ ([Ca2+]i) measurements were conducted using Fluo-4/AM (5 µM; Invitrogen)-loaded cells ...
-
bioRxiv - Neuroscience 2024Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (Termo Fisher Scientific, 90,115) for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco). All cells were cultured at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... 94°C 5 min) with 4 μl of RNA and random hexamers (Thermofisher scientific). A PCR was further performed based on the protocol established by Tiller et al (Tiller et al ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (Thermo Fisher Scientific, 90115) for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with 5 µg/ml NeutrAvidin (Thermo Fisher Scientific), then blocked in PBS containing 1% BSA for 1 hour at room temperature (RT) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (ThermoFisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 230C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... muscles were injected with 5 µM Fluo-4 penta-potassium salt (ThermoFisher Scientific, USA) as previously described and viewed with DIC optics on a Nikon Eclipse TE300 inverted light microscope (400× ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections of 4-5 μm were cut using a rotary microtome (HM355S, Thermo Scientific). Sections were deparaffinized in xylene and rehydrated in a descending series of ethanol (96%–50% ...
-
bioRxiv - Cell Biology 2023Quote: ... Medium was exchanged on DIV 4-5 for phenol-free Neurobasal medium (Thermo Fisher) supplemented with GlutaMAX 1x (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured at 37 °C and 5 % CO2 on 4-well plates (Nunc) (300 µl/well ...
-
bioRxiv - Neuroscience 2023Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (Thermo Fisher Scientific, 90115) for 15 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were incubated with 5 µM Fluo-4-AM (Thermo Fisher scientific, Waltham, MA) along with 0.1% pluronic F-127 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 7.3) containing 5 μM of the cytosolic Ca2+ indicator Fluo-4 AM (Invitrogen, Switzerland) solubilized in Krebs solution (in mM ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... serum Igs were purified from H10ssF-immunized mice (combined 2-4 weeks after the third immunization) by using protein A/G (Pierce Thermo Scientific). Seven mg of purified heperimmune Igs or control Igs or 100 μg (5 mg kg-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Jurkats were treated with 150mJ of UV energy and incubated for 2-4 hours at 37°C in complete media consisting of RPMI 1640 Media (Gibco, 11875101), 10% FBS (R&D Systems ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of the polar phase was collected and vacuum-dried at 4°C and subsequently derivatized with 2% (w/v) methoxyamine hydrochloride (Thermo Scientific) in pyridine for 60 min following by 30 min sialyation N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were fixed for 15 min at 37°C in 4% paraformaldehyde and incubated with 2 μM Bodipy 493/503 (Bodipy 493, Molecular Probes) and 1 μg/ml of DAPI as published (9) ...
-
bioRxiv - Cell Biology 2022Quote: ... were added to 1-2 mg of lysates for overnight incubation at 4 °C before the incubation with protein G Dynabeads (Life Technologies) for additional 2 hrs ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining 50 μL were incubated at 4 °C for 2 h with 40 μg of HisPur Ni–NTA magnetic beads (Thermo Scientific) pre-equilibrated in binding buffer ...
-
bioRxiv - Immunology 2021Quote: ... and 30×103 cultured on the irradiated 40LB cells with IL-4 in supplemented RPMI-1640 media (final: 10% FBS, 1x GlutaMAX™, 50µM 2-mercaptoethanol Thermo Scientific™ ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 20 μg of NKp46-IgG1Fc or NKG2D-IgG1Fc fusion protein at 4° C with rotary agitation for 16 h and then incubated with 2 mM of DTSSP crosslinker (ThermoFisher Scientific) for 2 h on ice ...
-
bioRxiv - Bioengineering 2021Quote: ... Medium containing lipid complexes was removed 4 h post transfection and replaced with exosome-depleted phenol red-free DMEM + 10% FBS + 2 mM L-glutamine (Thermo Fisher). Cells were incubated with 100 nM TO-1 in HBSS starting 30 minutes prior to imaging and for the duration of the imaging period ...
-
bioRxiv - Bioengineering 2020Quote: ... the media was removed and the gels were washed once with PBS prior to the addition of 500uL of 1X PBS with Calcein AM (2 µM) and Ethidium Homodimer-1(4 µM) (Invitrogen, L3224). After 45 minutes of incubating the stains ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.5-1.0 mg of cell lysate was incubated with 2-4 µg of antibody for 1 h followed by incubation with 8-10 µl of Protein G agarose (Thermo Fisher) for another 30-45 min ...