Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mice were deeply anesthetized with ketamine (400 mg/kg)/xylazine (50 mg/kg) by intraperitoneal injection and then perfused with 4% paraformaldehyde in 0.1 M phosphate buffer saline (PBS) (Fisher Scientific, Waltham, MA, USA). Liver ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were then trans-cardially perfused with 50 ml heparinised phosphate buffered saline (PBS) followed by 4% (w/v) paraformaldehyde (PFA; Fisher Scientific, Waltham, Massachusetts) in PBS (pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Biochemistry 2024Quote: ... Half of the culture medium was refreshed every 3-4 days with DMEM (Gibco, USA) supplemented with 10% FBS (CellMAX ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) and resolved (~80 μg/lane) in a linear 3-12% acrylamide gradient (Invitrogen). For BN-PAGE ...
-
bioRxiv - Biophysics 2024Quote: ... The Ca2+-sensitive dyes Fluo-4 AM (Dojindo) and Rhod-3 AM (Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cell Biology 2023Quote: ... in 0.01 M PBS (sodium chloride, potassium chloride, sodium phosphate dibasic, potassium phosphate monobasic, Fisher Scientific, Pittsburgh, PA), pH 7.3 ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was resuspended with 500 μL of filtered phosphate-buffered saline (PBS;10 mM phosphate, 140 mM NaCl, 2.68 mM KCl, pH 7.4, Gibco). The suspension was again centrifuged at 10,000 g for 3 min to remove the carry-over debris ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 mM MgCl2 containing 4.5 µM phosphate-binding protein labeled with a phosphate sensor (MDCC, Fisher Scientific) for intrinsic GTPase activity or containing 1 nM NF1-GAP for GAP mediated GTPase activity ...
-
bioRxiv - Microbiology 2022Quote: ... PAFB was labelled with the green fluorophore 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl ethylenediamine hydrochloride (BODIPY™ FL EDA, Invitrogen, Waltham, MA, USA) as described (32).
-
bioRxiv - Neuroscience 2021Quote: ... The brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 x 2 mins and blocked with SeaBlock blocking buffer (Thermo Fisher) for 15 mins at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... particle size = 3 μm, C18, L = 2 cm; analytical column: particle size = 2 μm, C18, L = 50 cm; PepMap, Dionex/Thermofisher). Peptides eluting from the column were ionized using an Orbitrap Elite (Thermofisher).
-
bioRxiv - Cell Biology 2020Quote: ... 2 X 105 PC3 or MCF7 cells were plated in either 6 well culture dishes (Nunc™ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI) for nuclear staining (Fluoromount-G™ Mounting Medium, with DAPI, Invitrogen), and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 50 μL of 2-6 μg/mL S was plated onto 384-well Nunc Maxisorp (ThermoFisher) plates in PBS and sealed overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Type 6 primary probes targeting MYCN were designed and synthesized by Affymetrix (Supplementary Table 2). Hybridization was performed according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed twice with PBS and stained with Laurdan dye (6-dodecanoyl-2- dimethylaminoaphthalene) (Thermofisher) at 10 µM for 45 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of reporters were transfected into cells in 6 well plate using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... real-time quantitative PCR was done using the ABI Quant Studio 5 and 6 (Life technologies, USA). The cDNA was used as template and DyNAmo Flash SYBR Green qPCR kit (#F-416L ...
-
bioRxiv - Cell Biology 2022Quote: ... about ∼5 μg of bacmid were transfected using 6 μl of Cellfectin II reagent (Thermo Fisher Scientific). 5 days after initial transfection ...
-
bioRxiv - Immunology 2021Quote: ... Sorted memory CD4+ T cells were labelled with 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester (CFSE, ThermoFisher) and cultured at a ratio of 2:1 with irradiated autologous monocytes untreated or pulsed for 3 h with recombinant SARS-CoV-2 Spike protein (2.5 μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfection with 5 ug total DNA in a 6 well plate was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... 6-well culture plates) for 8 days at 37°C and 5% CO2 in RPMI1640 (Life technologies) supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... HEK 293 cells were plated onto 6-well plates (2.5-4.5 × 105 cells per well) in 3 ml of MEM (Life Technologies) with 10% FBS (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were incubated with lentiviral supernatant and 3 days later selection begun with 6 μg/mL puromycin (Thermo Fisher), which was maintained during all subsequent culturing.
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Evolutionary Biology 2020Quote: 3-6-day old female ovaries were dissected from each experimental genotype and placed directly in Trizol reagent (Invitrogen), and homogenized ...
-
bioRxiv - Neuroscience 2024Quote: ... n=6) before being perfused intravenously with fluorescent Texas Red 40 kDa Dextran (3 mg/kg; D1829, Fisher Scientific) as described in previous studies (25,26 ...
-
bioRxiv - Neuroscience 2023Quote: ... The parental hiPS cell line (8858-3) was maintained in 6-well plates using StemFlex medium (Life Technologies, A3349401). Cas9 ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 µg of DNA was mixed with 6 µL of Lipofectamine 3000 in 250 µL opti-MEM (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... in 1x PBS (phosphate buffer saline, Gibco) and pH was adjusted to 9 with sodium bicarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... washed in Phosphate Buffered Saline (PBS) (Gibco) and stained with 20% v/v ethanol-violet crystal solution for 15 min.
-
bioRxiv - Neuroscience 2021Quote: ... in phosphate-buffered saline (PBS; Fisher Scientific). Antibody dilutions and commercial sources for images used in this study are described in table 1.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5mL 1X tryptose phosphate buffer (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... Sterile phosphate buffered saline (PBS) (Fisher Scientific) was used as a negative control in each DNA amplifications steps.