Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Cell Biology 2020Quote: ... old media was removed from the flasks and the cell layers were washed twice with 5 ml of Dulbecco’s phosphate-buffered saline (cat. 14190250, Life Technologies, Carlsbad, CA). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting promoterless pLenti-puro plasmid was then digested with EcoRI and the 5’ phosphates were removed with Calf Intestinal Alkaline Phosphatase (Thermo Fisher Scientific) to facilitate efficient ligation of the EcoRI-flanked gRNA scaffold ...
-
bioRxiv - Biochemistry 2020Quote: Cells from adherent cell lines were harvested by removing growth media and washing twice with 5 mL of pre-warmed Dulbecco’s Phosphate Buffered Saline (PBS) without calcium or magnesium (Gibco, Cat No. 14190094), then incubated in 3 mL of Gibco™ TrypLE™ Express Enzyme (1X) ...
-
bioRxiv - Bioengineering 2020Quote: ... retinal cells were resuspended in FACS buffer (1% Bovine Serum Albumin in Phosphate Buffered Saline) and stained with DAPI (5 µg/mL; catalog no. D1306; Life Technologies Australia) to exclude dead cells ...
-
bioRxiv - Microbiology 2022Quote: ... hCoV-19/USA-WA1/2020) at a MOI of 5 (titered in VeroE6 cells) in phosphate-buffered saline containing calcium and magnesium (PBS++; Gibco, 14040-133), and incubated at 37°C for 1.5 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... hCoV-19/USA-WA1/2020) at an MOI of 5 (titered in VeroE6 cells) in phosphate-buffered saline containing calcium and magnesium (PBS++; Gibco, 14040-133) and incubated at 37°C for 1.5 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: Phage particles were blocked with phosphate-buffered saline (PBS) with 5% BSA and depleted for nonspecific binders on M-280 streptavidin coated magnetic beads (Thermo Fisher Scientific). Biotinylated Human CD40L (Acro CDL-H52Db ...
-
bioRxiv - Neuroscience 2022Quote: ... for 5 mins at room temperature followed by a wash with 1% Bovine serum albumin in Phosphate buffer saline (PBS) (Thermo Fisher Scientific). The resuspended cell pellet was stained for anti-mouse CD3-PE (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: Cells were stained in phosphate buffered saline (PBS) containing 1 μg/mL propidium iodide (PI) and 5 μg/mL Hoechst 33342 (Thermo Fisher Scientific). The average number of PI-live cells per condition was determined using a CellInsight CX7 High Content Screening Platform (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... pelleted at 300 g for 5 min and washed once with cold 1× Dulbecco’s phosphate-buffered saline (PBS, Thermo Scientific, Gibco, Cat. #14190).
-
bioRxiv - Neuroscience 2024Quote: ... or Atp1a1s/s mice were anesthetized by inhalation of 5% isoflurane and injected with 20 µM ouabain in phosphate-buffered saline (PBS) (catalog number 14190144, Thermo Fisher Scientific) via a free-hand intracerebral injection ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed (3×) in phosphate-buffered saline with 0.1% Tween® 20 detergent (PBS-T, Cat. No. 20012-027, GIBCO PBS pH 7.2 (1X), Life Technologies Corporation ...
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Biochemistry 2024Quote: ... dsRNA complex (2:1 molar ratio) were cross-linked with 30 μg 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific, EDC: protein = 3:1 w/w) in the presence of 66 μg N-hydroxysulphosuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) at 37 °C for 5 min in PBTX solution ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4 °C for 2 h and eluted by TEV protease (Invitrogen) cleavage at 4 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue was then flash frozen with 2-methylbutane (O3551-4, Fisher Scientific) and stored at −75°C until sectioning.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were first loaded with Fluo-4-AM (2 μM, ThermoFisher, F14201) in Neurobasal A+ media for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... On day 4 cells were passaged 1:2 with Stempro Accutase (Invitrogen) for 5 minutes at 37C and replated on hESC qualified Matrigel® ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 24 mL 5% NaHCO3 (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were incubated with 4 μM Fura-2 AM (Invitrogen, F1221) and 0.4% Pluronic™ F-127 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: Cells (2×10^4) were plated in phenol-free RPMI (Life Technologies) with 10% FBS in 384-well plates and treated with varying doses of BRM011 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) were purchased from Gibco/Thermo Fisher Scientific (Grand Island ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 μL of a NeutrAvidin solution consisting of 4 μg NeutrAvidin (ThermoFisher) dissolved in 25 mM HEPES ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 2-hydroxyazobenzen-4’-caryboxylic acid (HABA)-avidin complex was used (Thermo Fisher). Quantification was measured at 500 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific), 1 × Glutamax ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Media was changed every second to third day and mucus clearance was performed every 4-5 days with 5 minutes apical PBS (ThermoFisher) incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... were incubated for 4 h in DMEM/F12 containing 5% horse serum (Gibco) and 5% foetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA (5 μg) was separated in 4-20% TBE gel (ThermoFisher scientific), described above.
-
bioRxiv - Microbiology 2021Quote: ... 14.5 μl of preheated reaction mixture [4 μl First Strand buffer (5 ×, Invitrogen), 1 μl 0.1 M dithiothreitol ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Neuroscience 2024Quote: Protein (5 µg) was loaded on NuPAGE 4–12% Bis-Tris gels (ThermoFisher), separated by electrophoresis and transferred to Hybond PVDF membrane (GE Healthcare) ...
-
bioRxiv - Physiology 2024Quote: ... cells were loaded with 5 µM of Fluo-4-AM (Thermo Fisher Scientific) or for 50 min at room temperature in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4-5 mg/mL of Ellman’s reagent (Thermo Fisher Scientific, Waltham, MA) were dissolved in a sodium phosphate buffer (0.1M NaH2PO4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were split every 4-5 days with TrypLE Select Enzyme (Life Technologies) as previously described ...
-
bioRxiv - Bioengineering 2020Quote: Upon the end of cultivation time (both 3 and 4 days) the medium was removed and each well was washed three times with 1x Phosphate Buffered Saline (PBS, Gibco, Invitrogen, California, USA) followed by fixation with 4% w/v Paraformaldehyde (PFA ...
-
bioRxiv - Genetics 2020Quote: ... samples were equilibrated in a 30% sucrose/phosphate buffered saline (PBS) solution at 4°C and then embedded in OCT compound (Fisher Scientific, Loughborough, UK) before 10μm sagittal sections were cut ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were then trans-cardially perfused with 50 ml heparinised phosphate buffered saline (PBS) followed by 4% paraformaldehyde (PFA; Fisher Scientific, Waltham, Massachusetts) in PBS (pH 7.4 ...