Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: In vivo labeling of tumor-infiltrating T lymphocytes (TILs) with 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG, Life Technologies, catalog: N13195) was done by intravenous (retroorbital ...
-
bioRxiv - Cancer Biology 2019Quote: ... human recombinant IL-2 (2 ng/ml) (Gibco, USA), IL-7 (10 ng/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 2 washes of 2× SSC (Ambion AM9765) for 5min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 mM GlutaMax supplemented with 2% B27 (Gibco) and 5% horse serum (Hyclone) ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 0.05 mM 2-mercaptoethanol (2-ME; Gibco). Mouse melanoma cell line B16 (ATCC ...
-
bioRxiv - Bioengineering 2023Quote: ... and recombinant human interleukin-2 (IL-2) protein (Invitrogen) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: The GyrA14-E487C and the CcdA50-72 peptide (Table S1) were labeled with Fluorescein-5-Maleimide and 5-TAMRA (Tetramethylrhodamine-5-Maleimide) from ThermoFisher Scientific as per the manufacturer’s protocol as described previously (Aghera et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of PAA premixes with 5% streptavidin–acrylamide (ThermoFisher, Cat#S21379) of the defined rigidity 48 were promptly sandwiched between the activated dish and the micropatterned coverglass immediately after adding a curing catalyst (aminopropyltriethoxysilane (APS)) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM MgCl2 and 5 or 10 mM caged ATP (#A1048 Invitrogen) prior to membrane wrapping ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with 5 μg FK506 (Invitrogen Cat. #INH-FK5-5). Thymi were taken for flow cytometry 24 or 48h after FK506 was administered ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... The PepMap100 C18 (5 μm 0.3 x 5 mm, Thermo Fisher Scientific) and the ACQUITY BEH C18 (1.7 µm 1.0 × 100 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 μl/IP anti-GFP (A-11122, ThermoFisher, 5 ul/IP), for 3 hours at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Bioengineering 2021Quote: Each sample (n=5) was placed in a 2 mL centrifuge tube containing 320 μL of collagenase II (Gibco, Thermo Fisher Scientific Inc., MA, USA) solution at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Plant Biology 2020Quote: Young seedlings were incubated in 20 μM 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit, ThermoFisher Scientific/Invitrogen, Waltham, Massachusetts, USA) made in ddH2O for 30 min at 24 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 RdRp IP2-targeted RdRp Institute Pasteur RT-PCR was performed on a QuantStudio™ 5 System (Applied Biosystems, Thermo Fisher Scientific). Log10 reduction values (LRV ...
-
bioRxiv - Cancer Biology 2021Quote: ... freshly isolated MNCs were washed and re-suspended in PBS and stained for 10 min at 37°C with 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) at a concentration of 5 µM (Thermo Fisher Scientific, Waltham, MA, USA). H2DCFDA is a non- fluorescent dye which is cleaved inside cells to 2’,7’-dichlorofluorescein (H2DCF) ...
-
bioRxiv - Immunology 2022Quote: ... cells from mice were isolated by flushing femurs and tibias with 5 mL PBS supplemented with 2% (v/v) heat-inactivated fetal bovine serum (FBS) Gibco (Thermo Fisher Scientific, Waltham, MA, USA). The BM cells were centrifuged for 5 minutes at 400 x g and then resuspended in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... at 37°C and 5% CO2 for 2 h in 12-well Nunclon™ Delta surface-treated flat bottom plates (Thermo Fisher Scientific, Waltham, MA). Non-adherent cells were removed by gently washing the cells with pre-warmed culture medium ...
-
bioRxiv - Genetics 2022Quote: ... Peptides were trapped on an Acclaim Pepmap 100 C18 trap column (100 μm x 2 cm, particle size 5 μm, Thermo Fisher Scientific, Waltham, MA, USA) and separated on an analytical column (75 μm x 35 cm ...
-
bioRxiv - Immunology 2024Quote: ... cells were thawed and rested in an 37°C / 5% CO2 incubator in the T cell medium with 50 U/mL rhIL-2 (Peprotech, Thermo Fisher Scientific, Waltham, MA, USA), for 4-24 hours prior to electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... purified and desalted by using a reversed phase trapping column (Acclaim PepMap 100 C18 trap; 100 μm × 2 cm, 100 A pore size, 5 μm particle size; Thermo Fisher Scientific, Waltham, MA, USA), and thereafter separated with a reversed phase column (Acclaim PepMap 100 C18 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A C18 trap column (length 2 cm, pore size 100 Å, particle size 5 µm, inner diameter 100 µm, Acclaim PepMap™ 100, #164199 Thermo Fisher Scientific, Lithuania), together with a C18 separation column (length 25 cm ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluorouracil (Fisher Scientific), 5-fluoroorotic acid (Fisher Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 mM HEPES (Gibco), 0.1% BSA (Abcone ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 % sodium bicarbonate (GIBCO), 1 % penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 5% HEPES buffer (Gibco) and 57% Distilled water (Versol) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 % horse serum (Gibco), 1 mM glutamine (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... and 5% FBS (Gibco) was used to resuspend concentrated viral stocks and aliquots were stored at −80°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5% FBS (Gibco), no antibiotics are used ...
-
bioRxiv - Genetics 2020Quote: ... 5% FBS (ThermoFisher, UK), Amphotericin B 250 μg/ml (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM HEPES (Gibco), 2% Triton X-100 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM HEPES (Gibco)) was added and tissue was bead beat for 1 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% horse serum (Gibco), 1x GlutaMax (Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mL Trizol (Invitrogen) was added to thawed pellets on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% Brij98 (ACROS Organics), 5% Lubrol WX (MP Biomedicals) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA (Gibco), 0.1 % SDS (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 5% FBS (Gibco) and 50 µg/mL penicillin/streptomycin (P/S) ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5% FBS (Gibco 26140) + 5% HS (Gibco 16050 ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5% HS (Gibco 16050) + 1% PS (Gibco 15140)] and placed in a humidified incubator (5% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μm (Thermo Scientific) C18 trapping cartridge ...