Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5% NCTC-109 (Gibco), 60 μM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% sodium pyruvate (GIBCO) and 5% penicillin and streptomycin (GIBCO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% horse serum (Invitrogen) and 10% FBS (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5% FBS (Invitrogen), 5% horse serum (HS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... 5 mM EDTA (Invitrogen), 200 mM NaCl (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 0.4 ug/mL Hydrocortisone (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 5-FU (Fisher Scientific), cytosine (Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 10 ng/mL human recombinant EGF (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytokeratin 5 (AB_2538529, Thermofisher), Cytokeratin 8 (ab53280 ...
-
bioRxiv - Biochemistry 2023Quote: ... + 5 % FBS (Gibco #10500064) under antibiotic pressure using 5 μg/ml blasticidin (Gibco #A1113903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized from 500 ng of total RNA using M-MLV reverse transcriptase (ThermoFisher) and subsequently diluted eightfold with water ...
-
bioRxiv - Cancer Biology 2021Quote: ... M-PER was supplemented with protease and phosphatase inhibitors (PPI; Thermo Scientific, Rockford, IL, USA). After aggressively vortexing these cells for 3x 1-minute increments ...
-
bioRxiv - Cancer Biology 2021Quote: ... they were resuspended in mammalian protein extraction reagent (M-PER; Thermo Scientific, Rockford, IL, USA) supplemented with protease and phosphatase inhibitor (PPI ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was stopped by addition of 12 μL 0.5 M EDTA (Thermo Fisher, 15575038) and incubation at 65°C for 20 minutes ...
-
bioRxiv - Genomics 2020Quote: ... and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen). The three IPs were pooled and purified using MinElute PCR Purification columns (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... Permeabilization buffer (PBS, 100 mM Na3O4V, 1 M NaF, 0.2% Triton-X (85111, ThermoFisher Scientific)) was added and after 1 minute samples were washed with PBS before blocking with passivation buffer (PBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... For each sample pool we retained only biotin-tagged fragments using Dynabeads M-270 (Invitrogen), and performed six separate ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were mixed with an equal amount of Dyna M-280 Streptavidin beads (Life Technologies). Samples were incubated for 2 hours while rotating at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... After addition of 50 μl of sheep anti-rabbit IgG Dynabeads M-280 (Thermo Scientific) were added and incubation was continued for 1 hr ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (100 ng) was reverse-transcribed using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA) and random primers ...
-
bioRxiv - Cell Biology 2022Quote: The preincubation of Dynabeads (100 μL) (Thermo Fisher Scientific, M-280 Sheep anti Mouse IgG) with primary antibody (5.0 μg ...
-
bioRxiv - Genomics 2020Quote: ... and chromatin immunoprecipitation was performed using Dynabeads M-280 sheep anti-rabbit IgG (Invitrogen #11203D) mixed with 5 µg anti-H3K4me3 antibody (Millipore 04-745) ...
-
bioRxiv - Genomics 2019Quote: ... The supernatant was transferred to a new tube and incubated with Dynabeads M-270 (Invitrogen) bound with anti-FLAG antibody (10 μg ...
-
bioRxiv - Biophysics 2019Quote: Streptavidin-coupled beads with a diameter of 2.7 μm (Dynabeads® M-270 Streptavidin, Invitrogen) were washed three times with 0.1% BSA (w/v) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to get rid to free dUTP and subsequently bound to Dynabeads M-280 Streptavidin (Invitrogen) by rotating 20 min at RT ...
-
bioRxiv - Cell Biology 2019Quote: ... The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads, M-270 Epoxy, Invitrogen) slurry coated with GFP-nanobody for 1 hour at 4°C (Cristea et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA was prepared using OligodT and reverse transcriptase M-MLV (Invitrogen®, Carlsbad, CA; USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... One µg of RNA was used to synthetize cDNA using M-MLV reverse transcriptase (Invitrogen) with oligo-dT and random hexamers ...
-
bioRxiv - Genomics 2019Quote: Buffers DNase- and RNAse-free TRIS.HCl 1.0 M pH 8.0 Ultrapure was purchased from Invitrogen. and 1.0M pH 7 from Sigma ...
-
bioRxiv - Genetics 2020Quote: Selection of only PstI-MluCI fragments was accomplished using Dynabeads M-280 Streptavidin beads (Invitrogen) to capture fragments with biotin incorporated at their P5 ends during PreSelect PCR ...
-
bioRxiv - Immunology 2021Quote: Whole cell lysate extracts were prepared M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, 78503) supplemented with 1X Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Permeabilization buffer (PBS, 100 mM Na3VO4, 1 M NaF, 0.2% Triton-X (85111, ThermoFisher Scientific) was added and after 1 min samples were washed with PBS before blocking with passivation buffer (PBS ...
-
bioRxiv - Biophysics 2020Quote: ... Permeabilization buffer (PBS, 100 mM Na3O4V, 1 M NaF, 0.2% Triton-X (85111, ThermoFisher Scientific)) was added and after 1 min samples were washed with PBS before blocking with passivation buffer (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... The tissues were then embedded in M-1 Embedding Matrix (Thermo Fisher Scientific, Waltham, MA), transversely sectioned at 20 μm using a cryostat (Leica Microsystems ...
-
bioRxiv - Bioengineering 2020Quote: ... Both CD8+ T cells and TN/M cells were stimulated with CD3/CD28 Dynabeads (ThermoFisher) at a 3:1 cell-to-bead ratio on Day 0 (day of isolation ...
-
bioRxiv - Microbiology 2020Quote: ... The ligated RNA fragments were reverse-transcribed to single-stranded cDNAs using M-MuLV (Invitrogen) with RT primers (as recommended by Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... and the reverse transcription for cDNA synthesis was performed using M-MLV (Invitrogen, 28025-013). The amplification reactions for qualitative PCR were performed using Recombinant Taq DNA polymerase (Invitrogen ...