Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Clec12a-Fc or Fc only fusion proteins were isolated with Pierce™ Classic Magnetic IP/Co-IP Kit (Thermo Fisher Scientific, Catalog number: 88804), quantified with Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific Catalog number ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Calu-3 (human, Caucasian, lung, adenocarcinoma) cell line was obtained from ATCC and maintained in Minimum Essential Medium (MEM; Gibco, Thermo-Fisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Physiology 2020Quote: ... and PCR was performed on the QuantStudio 6 Flex system (3 technical replicates per mouse, Applied Biosystems, Iowa Institute of Human Genetics). Gene expression was calculated using the ΔΔct method (39 ...
-
bioRxiv - Genomics 2021Quote: Human brain tissues were manually dissected into small 2-3 mm3 pieces and immersed in homogenization buffer (HBSS (Life Technologies, 14175-095), 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 11D5-3 single chain variable fragment (scFv)3 and the human heavy-chain-only FHVH3316 were codon-optimized and synthesized by GeneArt (Thermo Fisher Scientific). Retroviral constructs encoding APRIL CARs ...
-
bioRxiv - Molecular Biology 2022Quote: Keratinocytes were transfected with either HOXC13-AS siRNA or control siRNA for 24 hours (n=3 per group) and transcriptomic profiling was performed using human Clariom™ S assays (ThermoFisher Scientific) at the core facility for Bioinformatics and Expression Analysis (BEA ...
-
bioRxiv - Bioengineering 2023Quote: Human prostate adenocarcinoma cell line PC-3 was maintained in DMEM (HyClone, Cytiva) plus 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), and 100 Units/ml Pen-Strep (GIBCO ...
-
bioRxiv - Bioengineering 2023Quote: Human prostate adenocarcinoma cell line PC-3 was maintained in DMEM (HyClone, Cytiva) plus 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), and 100 Units/ml Pen-Strep (GIBCO ...
-
bioRxiv - Neuroscience 2024Quote: ... Phosphorylation was induced by incubating 1 µg of recombinant human polo-like kinase 3 (PLK3) protein (Thermo Fisher Scientific, MA, USA; #PR7316B) with 50 µL of mouse WT α-synuclein in kinase reaction buffer for 8 hrs at 30°C ...
-
bioRxiv - Immunology 2024Quote: ... we co-transfected 3×106 3-day activated CD8+T cells with 150 pmol/106 cells of human TSP-4-specific siRNAs (#s14100, Thermo Fisher Scientific) and 1.5 μg/106 of the pMax-TSP-1-GFPSpark construct ...
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 10% fetal calf serum (FCS, Thermo Fisher Scientific), 2mM glutamine and 100 μg/ml penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 15% FCS and non-essential amino acids (Gibco).
-
bioRxiv - Cell Biology 2020Quote: ... plus 10 % FCS (Gibco, Thermo Fisher, Waltham, MA, USA, #10270), 2 mM L-glutamine (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 10% FCS (GreinerBioOne) and gentamycin (Thermo Fisher Scientific) at 37°C and 5% carbon dioxide to maintain cell line stock ...
-
bioRxiv - Immunology 2022Quote: ... FCS from an EU-approved origin was obtained from Invitrogen-Thermo Fisher Scientific and heat-inactivated prior to usage ...
-
bioRxiv - Cell Biology 2022Quote: ... in DMEM containing 20% FCS and antibiotic-antimycotic (100×) (Gibco) for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... then Fc receptors blocked with normal mouse serum (Thermo Fisher) and TruStain FcX αmouse CD16/32 (Biolegend ...
-
Ouabain enhances cell-cell adhesion mediated by β1-subunits of the Na+,K+-ATPase in CHO fibroblasts.bioRxiv - Cell Biology 2019Quote: ... supplemented with 10% fetal calf serum (FCS) (200-6170, Invitrogen), 100 U/ml penicillin ...
-
Ouabain enhances cell-cell adhesion mediated by β1-subunits of the Na+,K+-ATPase in CHO fibroblasts.bioRxiv - Cell Biology 2019Quote: ... supplemented with 10% fetal calf serum (FCS) (200-6170, Invitrogen), 100 U/ml penicillin ...
-
Stem cell delivery to kidney via minimally invasive ultrasound-guided renal artery injection in micebioRxiv - Cell Biology 2019Quote: ... supplemented with 10% fetal calf serum (FCS, Invitrogen, Paisley, UK) in a humidified incubator at 37°C with 95% air and 5% CO2 ...
-
bioRxiv - Microbiology 2019Quote: ... Perfluoro-compound FC-72 was from Fisher Scientific (Illkirch, France).
-
bioRxiv - Microbiology 2020Quote: ... and 5% FCS with Lipofectamine 3000 reagent (Thermo Fisher Scientific) or Transit LT-1 (Mirus ...
-
bioRxiv - Bioengineering 2021Quote: ... IgG Fc-HRP goat-anti-mouse secondary antibody (Invitrogen A16084) was then added at a 1:10,000 dilution (in 1%BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... and supplemented with 5% lipoprotein-deficient serum FCS (Life Technologies), and 1% non-essential amino acids (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with foetal calf serum (FCS; 2 %; Thermo Fisher Scientific) and EDTA (2 mM ...
-
bioRxiv - Microbiology 2020Quote: VHH-72-Fc was expressed in ExpiCHO cells (ThermoFisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco), 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% FCS (Biowest, Nuaillé, France) and antibiotics (Gibco). If not stated differently ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were disassociated and re-suspended in 10% FCS (GIbco) 1xPBS and analysed using a BD LSRFORTESSA X-20 and dead cells were excluded using Hoechst’s (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 20% fetal calf serum (FCS) (Gibco Thermo Fisher), 1 % penicillin/streptomycin (PAA) ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 20% fetal calf serum (FCS) (Gibco Thermo Fisher), 1 % penicillin/streptomycin (PAA) ...
-
bioRxiv - Immunology 2022Quote: ... Media were supplemented with 10% fetal calf serum (FCS) (Gibco) and 100 U ml-1 penicillin-streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10 % fetal calf serum (FCS, Cat# 10270106, Gibco), or in FluoroBrite DMEM supplemented with 10 % FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10 % fetal calf serum (FCS, Cat# 10270106, Gibco) and 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10 % fetal calf serum (FCS, Cat# 10270106, Gibco), 1 % Pen/Strep (Cat#10378016 ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10 % fetal calf serum (FCS, Cat# 10270106, Gibco) and 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10 % fetal calf serum (FCS, Cat# 10270106, Gibco) and 2 mM L-glutamine ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 10% heat-inactivated FCS (PAA Laboratories, Thermo Fisher Scientific), gentamicin (10 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... containing 1% (v/v) foetal calf serum (FCS) (Life Technologies) and 25 mM HEPES buffer (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... 1% ES culture grade fetal calf serum (FCS) (Life Technologies), 1x non-essential amino acid (NEAA ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% fetal calf serum (FCS) (Thermo Fisher Scientific), and 50μg/ml gentamycin (PAN Biotech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 10% fetal calf serum (FCS) (Thermo Fisher Scientific) and 1% GlutaMAX (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with 15% fetal calf serum (FCS) (Thermo Fisher Scientific), 0.1 mM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and collected in RPMI medium with 10% FCS (Life Technologies). Cells were pelleted by centrifugation and washed twice in ice-cold PBS (14190-094 ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated foetal calf serum (FCS) (Gibco), 100 U/ml penicillin and 100 µg/ml streptomycin (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... Plating media (BME with 10% FCS and 0.1% gentamycin (Gibco)) was added to stop the digestion reaction ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10% v/v foetal calf serum (FCS, Gibco), 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... VHH-72- Fc was expressed in ExpiCHO cells (ThermoFisher Scientific) and purified from the culture medium as described34 ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% Heat inactivated Foetal Calf Serum (FCS, Gibco), 100 U/mL Streptomycin (Gibco) ...