Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 3952 citations for Rubella Virus VLP strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of the respective strain were spotted on a 1% PBS-agarose (select agar, Invitrogen). Fluorescence microscopy was performed as described previously (42) ...
-
bioRxiv - Microbiology 2024Quote: Glycerol stock of Escherichia coli (E. coli) (TOP10 strain, Invitrogen, Thermo Fisher Science, Waltham, MA, USA) transformed with plasmid pCR2.1 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... aureus (HIP10787 mupA positive QC strain Methycilin Resistant) sourced from Thermo Scientific (LENEXA, KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB ...
-
bioRxiv - Biochemistry 2023Quote: P.pastoris strain X-33 and the vector pPICZα C were purchased from Invitrogen (Thermo Fisher Scientific). E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA from each strain was quantified using the Qubit DNA Broad Range assay (ThermoFisher Scientific), diluted to the same concentration (10 ng/μL ...
-
bioRxiv - Biophysics 2023Quote: The hpt1Δ (MatA, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0, hpt1::KanMX) Saccharomyces cerevisiae yeast strain was from Invitrogen. The cells were cultured in synthetic complete (SC ...
-
bioRxiv - Microbiology 2023Quote: The bacterial strains used in this work unless otherwise stated were as follows DH5α (ThermoFisher Scientific). The plasmids and primers that were used in this study can be found in table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: AJY4049 was made by integrating PmeI-cut pAOL47-04 into a TIF6-GFP-expressing strain (Invitrogen). AJY3027 was constructed by sequential crossing appropriate haploid strains originally derived from the heterozygous deletion collection (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... and the ΔmelH complemented strain were determined using a BacLight Bacterial Membrane Potential Kit (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the strains were streaked out and grown on Remel Porphyrin Test Agar (PTA, Thermo Fisher Scientific), and/or blood agar (BA ...
-
bioRxiv - Microbiology 2020Quote: Concentrated live or inactivated virus samples were mixed with Novex™ Tris-Glycine SDS Sample Buffer (2X) (Thermofisher Scientific) with NuPAGE™ Sample Reducing Agent (10X ...
-
bioRxiv - Neuroscience 2020Quote: ... patient-derived fibroblasts were infected with Sendai virus using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Invitrogen, CA, US) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... RNA was reverse transcribed and amplified using TaqMan Fast Virus 1-Step Master Mix qRT-PCR Master Mix (Invitrogen) on the LightCycler 480 or LC96 instrument (Roche ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus titres were measured from a thawed aliquot by: (1) mixing 20 μl with 200 μl of TRIzol (Invitrogen); (2 ...
-
bioRxiv - Neuroscience 2019Quote: ... PBMCs were transduced with 2.0 Sendai virus particles containing four Yamanaka factors using the CytoTune-iPS Sendai Reprogramming Kit (ThermoFisher). After seven days ...
-
bioRxiv - Microbiology 2019Quote: ... Initial virus was recovered from T7 transcribed RNA using reverse transfection of Huh7.5.1 cells by Lipofectamine® 2000 (Invitrogen) (for virus rescue ...
-
bioRxiv - Microbiology 2019Quote: ... Two microliters of extracted RNA was amplified using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) according to the manufacturer’s protocol and primers specific for HCoV-229E [30] or RSV-B [31] ...
-
bioRxiv - Microbiology 2021Quote: ... Virus prepared for purification by ultracentrifugation was grown in serum-free media (VP-SFM; Gibco, ThermoFisher Scientific, Waltham, MA) supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... Virus prepared for purification by ultracentrifugation was grown in serum-free media (VP-SFM; Gibco, ThermoFisher Scientific, Waltham, MA) supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... a homolog of the vaccinia virus H3L gene) [13] using the Path-ID™ qPCR Master Mix (Thermofisher Scientific). Nucleic acid from capripoxvirus positive samples was further analysed by a qPCR targeting LSDV011 designed to differentiate the three capripoxvirus species [14] and a qPCR targeting LSDV008 designed to differentiate LSDV wildtype strains from Neethling vaccine strains [15] ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR reactions were performed with Taq-Man™ Fast virus 1-step master mix (ThermoFisher Scientific, Cat. 4444436) and primer-probe sets targeting SARS-CoV-2 nucleocapsid (N1 set ...
-
bioRxiv - Microbiology 2020Quote: ... Virus stocks were generated by transfecting the clone into Vero cells using Lipofectamine 2000 (Thermo Fisher, cat# 11668-019), and harvested at various times post-transfection.
-
bioRxiv - Microbiology 2021Quote: ... Virus was quantified using real-time PCR using SYBR Premix Ex Taq™ (Applied Biosystems, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Virus was quantified using real-time PCR using SYBR Premix Ex Taq™ (Applied Biosystems, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... the protein was expressed as a fusion construct with an N-terminal His6 tag followed by tobacco etch virus (TEV) protease cleavage site in E.coli BL21 DE3 Star cells (Invitrogen). The fusion construct was purified using immobilized-nickel affinity chromatography ...
-
bioRxiv - Microbiology 2021Quote: ... virion concentration was determined indirectly through the DNA absorbance at 260/280nm of the virus stock (NanoDrop, Thermo Scientific). The MOI equivalent (MOI eq. ...
-
bioRxiv - Cancer Biology 2020Quote: ... converted to cDNA by RT with random hexamers and Moloney murine leukemia virus (MuLV) reverse transcriptase (Thermo Fisher Scientific) and used in PCR with the following primers ...
-
bioRxiv - Microbiology 2021Quote: 400,000 CEM-SS or CEM-T4 cells were infected with 1.6 ng of p24-CA of wildtype or mutant NL4-3 virus in serum-free RPMI medium (Invitrogen) at 37 °C ...
-
bioRxiv - Biophysics 2020Quote: ... PCoV_GX and RaTG13 pseudoviruses were generated by co-transfection of human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the respective spike protein into 293T cells (ATCC) ...
-
bioRxiv - Biochemistry 2022Quote: ... A high-titer virus stock for hPolεCD(insect) was obtained by using the Bac-to-Bac Baculovirus Expression System from Invitrogen. 1.8×109 Sf21 cells in 1 L shaking culture were infected with the recombinant virus at a multiplicity of infection of 2 and cultivated at 27 ºC for 56 hr ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant P0 virus for each gene were generated in ExpiSf9 insect cells following the manufacturer’s recommendations (Thermo Fisher). The amount of each virus needed for infection has been optimized for maximal production of the two proteins ...
-
bioRxiv - Microbiology 2020Quote: ... Two microliters of extracted RNA were amplified using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 4 x TaqMan® Fast Virus 1-Step Master Mix made up with molecular-grade nuclease free water (Ambion) to a final volume of 15 μl ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed as previously described using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher, Cat#4444436) and an OneStepPlus Real-Time PCR System (96-well format ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were placed in a stereotaxic apparatus to receive bilateral infusions of the virus or 0.5% (w/v) cholera toxin subunit B (CTb) Alexa Fluor 555 Conjugate (Invitrogen) into the dorsal striatum (+0.1mm antero-posterior ...
-
bioRxiv - Microbiology 2020Quote: ... one for virus quantitation (TCID50) and the other for vRNA extraction in TRIzol (ThermoFisher, 15596026; 1 in 3 dilution). Samples were stored at -80°C until required ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR was performed according to the manufacturer’s instructions using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) and a OneStepPlus Real-Time PCR System (96-well format ...
-
bioRxiv - Microbiology 2022Quote: ... MRC-University of Glasgow Centre for Virus Research) were maintained in complete media (Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% Foetal Bovine Serum (FBS ...
-
bioRxiv - Pathology 2022Quote: ... RNA was reverse transcribed and amplified using the TaqMan Fast Virus 1-Step Master Mix RT-qPCR kit (Invitrogen) on the LightCycler 480 or LC96 instrument (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was amplified by RT-qPCR using the Taqman Fast Virus 1-step master mix (Thermo Fisher Scientific). Primers and probes targeting SARS-CoV-2 RNA-dependent RNA polymerase were described in [25] ...
-
bioRxiv - Genomics 2019Quote: ... we reprogrammed fibroblast samples from the 181 individuals in this study using non-integrative Cytotune Sendai virus (Life Technologies) (Ban et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... complementary DNA was then reverse transcribed from 1 μg total RNA with Moloney murine leukemia virus reverse transcriptase (Invitrogen), using random hexamer oligonucleotides for priming ...
-
bioRxiv - Microbiology 2020Quote: ... The purified virus was dissolved with an equal volume of 2x Tris-Glycine SDS Sample Buffer (Thermo Fisher Scientific) and boiled for 5 min without a reducing agent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Expression levels of MYC and MEIS1 transcript were quantified using TaqMan Fast Virus 1-Step Master Mix (Life Technologies) using PrimeTime qPCR Probe Assays from Integrated DNA Technologies in a 3:1 ratio of primer to 5′ 6-FAM and 3′ TAMRA labeled probe ...
-
bioRxiv - Microbiology 2020Quote: ... and infected at an MOI of 1 with the VSVΔG:mNeon/VSV-G virus diluted in 10 mL Opti-MEM (Life Technologies). The cells were incubated 1 hour at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-well plate format) mock- or virus-infected (MOI of 0.01) were extracted using TRIzol reagent (Thermo Fisher Scientific). Superscript® II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: Virus was generated by transfecting 3×106 HEK293T cells with plasmids using Lipofectamine 2000 (Thermo Scientific, Cat. No. 11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... and then inoculated intranasally (i.n.) with 30 μL of virus (0.5 HAU) diluted in Dulbecco’s phosphate-buffered saline (DPBS) (Gibco, Loughborough UK). Mock-treated control mice were inoculated similarly with DPBS ...
-
bioRxiv - Microbiology 2021Quote: ... was propagated on Vero E6 cells at a multiplicity of infection (MOI) of 0.001 in virus diluent (DMEM supplemented with 2% FBS, 1X Penicillin/Streptomycin (Gibco), 1mM sodium pyruvate (Gibco ...