Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 10000+ citations for 6 Propyl 2 thioxo 2 3 dihydropyrimidin 4 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then washed 3× with PBS and incubated for 1h with the corresponding Alexa Fluor secondary antibodies (Thermo Fisher Scientific) at 1:1000 dilution (in 3% BSA ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Microbiology 2021Quote: ... a sequencing reaction was performed with 2 pmol of unmodified RNA and 2 µl of a 2 mM AS primer 1 labeled with Ned (Life Technologies SAS, France). Reverse transcription was performed as for the SHAPE (+ ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Pathology 2019Quote: ... IL-6 and IL-10 levels were assessed using ELISA kits (Cat# 88-7324-22, BMS603-2, 88-7105-22 Thermofisher, USA). The intensity of the colour was measured using a microplate reader (Thermal ...
-
bioRxiv - Bioengineering 2020Quote: Each gel electrophoresis reaction used 6 µL of unbound B56 protein-antibody complex and 2 µL of 4x SDS-PAGE sample buffer (Thermo Fisher). After heating the samples to 95 C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfection of 2 µg pSpCas9-BB-2A-GFP-sgYBX1 was carried out with 6 µl of Lipofectamine 2000 (Thermo Fisher Scientific) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Cells (1-2.5 x106/mL) were then cultured at 37 °C ex vivo for 2-6 hours in RPMI (Gibco, 21875-034) containing 10% FCS (IGC Technical Services ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500ng circRNAs per well for 24-well plates (2 μg for 6-well plates) were transfected with lipofectamine MessengerMax (Invitrogen, LMRNA003) on the next day when the cell culture must have >90% viability and be 70% confluent ...
-
bioRxiv - Physiology 2019Quote: Control and VDR-KD cells were plated at 1.0 × 1010 cells/well in 2 ml of growth medium in 6-well plates (Nunc, Roskilde, Denmark). Both myoblasts and myotubes were maintained and harvested as described previously ...
-
bioRxiv - Immunology 2021Quote: The Fab fragments of Clone 2 and Clone 6 were generated from full length IgGs of Clone 2 and Clone 6 using a commercial PierceTM Fab Preparation Kit (Thermo Fisher). All procedures were performed following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Reporter plasmids (2 μg) were transfected into HEK-293 cells in 6-well plates at ∼60-90% confluency using Lipofectamine 3000 (ThermoFisher Scientific). Cells were harvested after 1 day by aspirating the media and resuspending the cells in 1 mL Trizol reagent (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transfected using 1-2 µg of pMX-GFP or pMX-53BP1 vectors and 6 µL Lipofectamine 2000 (Thermo Scientific). The media was changed after 3 hours of incubation ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were treated with RSL3 for 2 h or IKE for 6 h together with the indicated compounds before BODIPY 581/591 C11 (Thermo Fisher) was added in a final concentration of 2 μM per well and incubated for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The cell concentration was diluted 1:6 and cultured in 2 mL of Essential 8 (E8) - Flex Medium Kit (ThermoFisher Scientific) supplemented with 1% Penicillin Streptomycin (GIBCO ...
-
bioRxiv - Molecular Biology 2023Quote: Phosphor imaging of [γ-32P] radio-labelled DNA sequences was accomplished through 6% denaturing PAGE constituted of 1X TBE (89 mM Tris base, 2 mM EDTA and 89 mM boric acid, Fisher Scientific) (57) ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1,000g for 2 min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... SVG-A Notch2-HaloTag cells were transfected in 6 well plate format with 2 µg of DNA per well using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein pellets were resuspended in urea buffer (6 M urea, 2 M thiourea, 100 mM ammonium bicarbonate, pH 8.0) and quantified using EZQ (Invitrogen/Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... a dry transfer was completed at 30V for 6 min with PVDF stacks in an iBlot 2 transfer instrument (Thermo Fisher). After gel transfer ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells were seeded on a 6-well plate (2×105 cells per well) and were cultured in low glucose Dulbecco’s Modified Eagle Medium (Thermo Fisher Scientific) supplemented with 10% FBS and 1% sodium pyruvate ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antigen unmasking was performed by microwaving the slides for 2 × 10 min in citrate buffer solution (pH 6) (Thermo Fisher Scientific). Sections were then blocked for 1 hour at room temperature with 10% normal donkey serum (Chemicon International Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf9 cells were seeded at 5·105 cells/ml in a 6-well plate in a total volume of 2 ml of Sf-900-II SFM media (10902088, ThermoFisher Scientific). Bacmids (see above ...
-
bioRxiv - Bioengineering 2023Quote: ... sections were counterstained with 1 mg/mL of 4’,6-diamidino-2-phenylindole (DAPI) and 0.1 nmol units/ml of Phalloidin ATTO647N and mounted with Fluoromount-G (Thermo Fisher Scientific). The slides were acquired using a confocal (Leica SP8 ...
-
bioRxiv - Neuroscience 2023Quote: ... including Camuiα were transfected into HEK293S GnTI-cells (2 x 106 cells per well in 6-well plates) cultured in FreeStyle 293 (Thermo Fisher), using the TransIT2020 transfection reagent (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2024Quote: Total protein was extracted from 1-2 wells of a 6-well plate using RIPA lysis buffer with protease inhibitor (ThermoFisher Scientific). Protein concentration was measured using Pierce BCA kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Concentration of each sample was adjusted to 2 μg/μl and then mixed with 6 X SDS-containing Laemmli buffer (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... TRAIL blocking ab was purchased from Santa Cruz TRAIL Antibody (RIK-2): sc-56246, and IFN gamma blocking Monoclonal Antibody (NIB42, #6-7318-81) was purchased from Thermo Fisher. The blocking mAb was added when NK cells were combined with tumor cells.
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... Neuro-2a cells were cultured on 6-well plates and then transfected with a total of 2 µg of an expression plasmid using Lipofectamine 2000 (Invitrogen, USA) as per the instructions provided by the manufacturer.
-
bioRxiv - Cell Biology 2024Quote: ... and these values were re-calibrated based on measurements of NIST-certified polystyrene beads (2 µm and 6 µm in diameter, Duke Standards, Thermo Scientific).
-
bioRxiv - Immunology 2024Quote: ... non-sun-exposed skin as previously described(13) and used at passages 2-6 and grown in Epilife medium (Gibco, #MEPI500CA) with added human keratinocyte growth supplement (10ul/ml medium) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1000 μg of total protein was incubated overnight at 4 °C with 2 μg α-GFP (Life Technologies/ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were sorted by gating on the DAPI peaks using a BD FACS Aria III (200,000 – 400,000 events) into a small volume of landing buffer (4% BSA in PBS, 2 U/µl Ambion RNase Inhibitor ...
-
bioRxiv - Biochemistry 2020Quote: ... and 4 mM TCEP using a 2 mL 7,000 MWCO Zeba spin desalting column (ThermoFisher Scientific, Waltham MA). The desalted protein was incubated with 40 μL of 10 mM AlexaFluor-647 C2 maleimide (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Transient transfections were performed by adding 2-3μg of the appropriate vector in conjunction with 4-6μL Lipofectamine transfection reagent (Invitrogen). Cell culture media was changed 12 hours post-transfection and replaced with fresh media ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mL and 4 mL glass vials and ultraclean Silicone/PTFE septa caps (Thermo Fisher, Waltham, MA, USA) were used for biology ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 µm particle size, Thermo Fisher Scientific) equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm ...
-
bioRxiv - Cell Biology 2021Quote: ... equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm, 4 µm, Thermo Fisher Scientific). The column temperature was held at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were permeabilized in FACS Buffer (DPBS without calcium and magnesium, 4% FBS, and 2 mM EDTA (Gibco)) with 0.5% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 3,4-dihydroxystyrene and 2-methoxy-4-vinylphenol concentrations were quantified using a Dionex UltiMate 3000 HPLC (Thermo Scientific) with a Discovery® HS-F5-3 column (15 cm x 2.1 mm ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the rest was immunoprecipitated at 4°C for 2 h using Dynabeads Protein A (Life Technologies, # 10008D)-conjugated anti-m6A antibody (Synaptic systems ...
-
Proteome of the secondary plastid of Euglena gracilis reveals metabolic quirks and colourful historybioRxiv - Evolutionary Biology 2019Quote: ... containing 2 mM dithiothreitol and separated on a NuPAGE Bis-Tris 4–12% gradient polyacrylamide gel (Thermo Scientific) under reducing conditions ...