Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... 50 μl of the re-suspended sample were diluted 1:5 with LC MS-grade water and analyzed using a Dionex ion chromatography system (ICS 5000, Thermo Scientific). The applied protocol was adopted from 72 ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µl of TaqMan® RT-PCR mix (TaqMan® RNA-to-CtTM 1-Step Kit) (Applied Biosystems, Waltham, MA, USA), 0.5 µl of TaqMan® RT-Enzyme Mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... Triton X-100 in 200 μL of PBS for 5 min and subsequently incubated in 100 μL of click reaction buffer (1× Click-iT cell reaction buffer [Thermo Fisher Scientific] ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid DNA at a concentration of 1-2 mg/ml was mixed with 5 µl of Salmon Sperm DNA (10mg/ml) (Thermofisher Scientific) prior to electroporation ...
-
bioRxiv - Cancer Biology 2020Quote: 3×105 viable hCD4+ or mCD8+ T cells were stained with 1 μM of CellTracker Green CMFDA (5-chloromethylfluorescein diacetate; Thermo Fisher) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 serial dilutions of 1:5 were made for each sample and then quantified using Fast SYBR Green Master Mix (Applied Biosystems) on a 7500 FAST Real Time PCR System (Life technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 μL of resuspended cells were diluted in 1 mL PBS through a 35 μm filter (Corning Falcon tube, Thermo Fisher). FACS DIVA software was used to collect 100,000 events for each sample ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesised from 1-5 μg of template RNA using he Thermo Scientific RevertAid H Minus First Strand cDNA Synthesis Kit by Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2020Quote: ... Devices were washed twice with PBS followed by one rinse with 3% NGS plus 0.1% Tween-20 for 5 min each with rocking and secondary antibodies Alexa Fluor 488 goat anti-mouse IgG (Thermo Fisher) and Alexa Fluor 555 goat anti-rabbit IgG (Thermo Fisher ...
-
bioRxiv - Systems Biology 2021Quote: ... with an estimated each concentration of 1-5 ng/μl were incubated in the blocking solution with 100-fold diluted SUPERase In RNase Inhibitor (Invitrogen AM2694) at room temperature for 18-24 hours ...
-
bioRxiv - Genomics 2021Quote: ... and strained through a 40-μm filter (pluriSelect) then stained for 5 min with Propidium Iodide (1 mg/mL, ThermoFisher Scientific) at room temperature to label dying cells.
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were washed five times with lysis buffer containing 1 M NaCl and incubated with 25 µl of biotin elution buffer (lysis buffer with 5 mM D-biotin [Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... siRNA reverse transfection was performed by mixing 1.2 μl siRNA 5 μM with 1 μl lipofectamine RNAiMAX transfection reagent (Invitrogen, ThermoFisher Scientific) to a final volume of 100 μl with Opti-MEM® (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... the reserved 1 mL of ham solution was subjected to decimal dilutions and plated on Columbia agar with 5% sheep blood (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cells were stained with anti-mouse fluorochrome-conjugated antibodies: CD4 PE-eFluor 610 (1:400, RM4-5, Thermo Fisher Scientific), CD8a PE (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed twice for 5 minutes in PBS and once in PBS with Hoechst 33342 (1:1000, Molecular Probes) before mounting with VECTASHIELD® Antifade Mounting Media (Vector Laboratories) ...
-
bioRxiv - Cell Biology 2021Quote: ... incubation with secondary antibody was performed in 0.5% BSA/PBS for 1 hour at room temperature and nuclei were stained with 2 μg/ml Hoechst 33342 (Life Technologies). Images were acquired using the Leica SP8 confocal or Leica DMI6000-SD microscopes ...
-
bioRxiv - Cell Biology 2021Quote: ... HEMs were cultured in Medium 254 supplemented with 1% human melanocyte growth supplement (S-016-5, Cascade Biologics/Thermo Fisher Scientific) and 100 units/mL penicillin/streptomycin ...
-
bioRxiv - Synthetic Biology 2022Quote: On Day 1: 500 µl of 10 µg/ml S1-hFc or RBD-mFc was coated in a 5 ml immunotube (NUNC, 444202) overnight at 4°C ...
-
bioRxiv - Systems Biology 2022Quote: ... secondary antibodies were used for 1 hour at room temperature in 5% BSA and 0.3% Triton-X in PBS: Alexa Fluor 594 conjugated anti-mouse (1:1000; Invitrogen #A-11032) and Alexa Fluor 488 conjugated anti-rabbit (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 40 cycles of 95°C for 1 s and 60°C for 20 s using the QuantStudio 5 Real-Time PCR System (Applied Biosciences, ThermoFisher Scientific). Specificity was verified by melt curve analysis ...
-
bioRxiv - Developmental Biology 2022Quote: ... and dissociated into single cells in 100 μl of Enzyme 1 and 5 μl of Enzyme 2 (Pierce Cardiomyocytes Dissociation Kit, ThermoFisher Scientific) for 30 min at 350 rpm shaking at 30°C ...
-
bioRxiv - Genomics 2022Quote: ... heterozygous and knockout colony were expanded in chondrocyte media supplemented with 5 ng/ ml bFGF and 1 ng/ml TGF-β1 (Life technologies) for 11 days ...
-
bioRxiv - Molecular Biology 2022Quote: ... were washed three times with Buffer A (PBS pH 8.3, 5% glycerol, 1 mM DTT, 0.03% NP-40, Pierce™ Phosphatase Inhibitor Mini Tablets (Thermo Fisher Scientific)) and incubated with 2 µg of un ...
-
bioRxiv - Molecular Biology 2022Quote: ... streptavidin particles with immobilized peptides were washed three times with buffer B (PBS pH 8.3, 5% glycerol, 1 mM DTT, 0.1% NP-40, Pierce™ Phosphatase Inhibitor Mini Tablets (Thermo Fisher Scientific), Roche Complete Mini EDTA-free protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... in 384 well plates with 0.5 μM forward and reverse primers (sequences in Supplementary table 1) run on a Viia7 Real-Time PCR machine (Thermo Scientific). Fold induction of the target gene was calculated relative to GAPDH in human cells and Hprt in murine cells.
-
bioRxiv - Molecular Biology 2022Quote: ... The secondary antibody was Alexa Fluor 549-conjugated goat anti-mouse IgG (H+L) (diluted 1:250 in PBST containing 5% goat serum, Invitrogen, USA) which was incubated overnight ...
-
bioRxiv - Neuroscience 2022Quote: Worms were washed with M9 buffer and incubated overnight in 1 ml M9 and 5 μl DiD dye (Vybrant™ DiD Cell-Labeling Solution, ThermoFisher) at ~10-20 rpm ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cultured with PDAC tumor organoids in the lower compartment of the 24-well plate in DMEM containing 5% FBS and 1% penicillin/streptomycin (Thermo Fisher). For IL1α neutralization experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.5 mM MgCl2, 10mM KCl, 0.1% Nonidet P-40 supplemented with 1 × Halt protease and phosphatase inhibitor cocktails, Thermo Fisher Scientific). One mg total cell protein was used per IP and 1% of the cell lysate volume was loaded as the input to assess the presence of desired proteins in each case ...
-
bioRxiv - Biochemistry 2022Quote: ... The secondary antibody (diluted 1:1000 in 5% GS in PBS, Alexa Fluor®488 goat anti-Rabbit, Thermo Fisher Scientific) was added for 1 h RT in dark ...
-
bioRxiv - Immunology 2022Quote: 90μL of paraformaldehyde fixed cells was incubated with 5 x 10-7 M DAPI and 1:100 Vybrant™ DiD Cell-Labeling Solution (Invitrogen) at 37C for 20 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... phosphatase inhibitor cocktail sets II and III) (1-5 mg tissue per ml of lysis buffer) and homogenised using a Bead Mill (Fisher Scientific). Laemmli buffer (0.004% bromophenol blue ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Viable splenocytes were co-cultured with the indicated tumor cell line at a ratio of 1:20 (tumor cell line: splenocyte) in the presence of anti-CD3/ anti-CD28 (5 μg/ml) (Life technologies) for 96 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: Cells were set at a concentration of 1 x105 cells/mL 24 hrs prior to EdU addition (5-ethynl-2’-deoxyuridine; Life Technology, Thermo Scientific) in media free from thymidine prepared using Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
bioRxiv - Microbiology 2020Quote: ... at a flow rate of 5 μL min-1 and separated via a 25 cm analytical column (Acclaim PepMap100 C18, 75 μm × 25 cm, Thermo Scientific) at 35°C using a constant flow rate of 300 nL/min ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were then rinsed five times in PBST for 5 min each and counter-stained with 1 μg/ml Hoechst 33342 (Thermo Fisher) for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed in 0.1 M TB (2 ×5 minutes) and counterstained with Hoechst 33342 (1:20000, #62249, Thermo Fisher Scientific) diluted in 0.1 M TB ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2022Quote: ... siRNA reverse transfection was performed by mixing 1.2 µl siRNA 5 µM with 1 µl lipofectamine RNAiMAX transfection reagent (Invitrogen, ThermoFisher Scientific) to a final volume of 100 µl with Opti-MEM® (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Neurons were then permeabilized with 0.1% Triton X-100/5% normal goat serum/PBS and incubated with anti-mouse Alexa-546 secondary antibody (1:1000; Thermo Scientific) for 2 hr ...
-
bioRxiv - Systems Biology 2022Quote: ... and the pellet washed with 1 ml cold acetone and sonicated for 5 s at 15% power using a Sonic Dismembrator Model 500 sonicator (Fisher Scientific), fitted with a microtip ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... Then the samples were washed in 5× SSCT containing DAPI (1:1000) and Alexa Fluor 488-conjugated Wheat Germ Agglutinin (WGA, 5μg/ml, Thermo Fisher Scientific) and with 5× SSCT for 30 min each at room temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting cDNA was diluted 1:10 and 2 μl of each sample was amplified using a QuantStudio 5 (Applied Biosystems) thermal cycler ...