Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... The coverslip with the sample was then inverted into the center of an imaging dish containing 150 μL of imaging buffer (Tyrode’s with 5% cosmic calf serum and 5 μg/mL Hoechst 34580 (Invitrogen #H21486), mixed by pipette and vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions were loaded onto a cartridge precolumn (5 mm x ID 300 μm, C18 PepMap 100 A, 5 μm particles (ThermoFisher)) ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were trapped and desalted on a C18-column (5 μm Acclaim PepMap100 300 μm x 5 mm, ThermoFisher Scientific) at a flow rate of 30 μl/min with solution A (1% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 along with penicillin and streptomycin antibiotics (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... One milliliter of the culture was incubated for 5 min (at 37°C) with the membrane dye Nile Red (5 µg/ml, Invitrogen), washed once with phosphate buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with the CofActor optogenetic system (6 µg plasmid/plate) on day in vitro 3-5 (DIV3-5) using Lipofectamine 2000 (Invitrogen). 48 hours post transfection ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... site-directed mutagenesis was performed as described in Liu & Naismith (32) using primers 5’-ACTACTTCGATGAGATCGCTCTGCTCATGAACCGTCCTCGTGCTG and 5’-AGCGATCTCATCGAAGTAGTCAGACGGTGCGAGTCTTCCAACCTC using Phusion Plus DNA polymerase (#F630S, ThermoFisher). Following confirmation of the RIαB G323D mutation by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... They have been regularly screened for mycoplasma infection using a PCR-based method with the primers Myco1 (5’-GGCGAATGGGTGAGTAACACG) and Myco2 (5’-CGGATAACGCTTGCGACTATG) (Invitrogen) and no cultures have tested positive.
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from an isolated two-kidney pool from each litter of the NP (n = 5) and LP (n = 5) offspring using Trizol reagent (Invitrogen), according to the instructions specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated in 5 ml of PBS containing 5 mg EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... epidermidis isolates collected from ocular sources were cultured in 5 ml of brain heart infusion broth (BHI) +5% fetal bovine serum (FBS, Gibco) and shaken at 250 rpm and 37°C for 12–16 h ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... and passed to the plating medium consisting of 5% horse serum and 5% fetal calf serum prepared in minimum essential medium (MEM, Gibco), enriched with 0.6% glucose ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transfected in suspension with 50 pmol per 3×105 cells of scrambled siRNAs (control, 5’UUCUCCGAACGUGUCACGU3’) or siRNAs specific for JIP4 (5’GAGCAUGUCUUUACAGAUCUU3’) using the transfection reagent LipofectamineR 2000 (Invitrogen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Control (vehicle: 40 μM HCL, 0.002% BSA [0-5 d]; 0.1% DMSO [5-10 d]; all from Thermo Fisher Scientific) for 0-10 d [=Baseline] ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 mM NaCl, 5 mM MgCl2, 5% glycerol, 0.5% Triton X-100, and 1X Halt protease/phosphatase inhibitor cocktail, Thermo Scientific) using a pre-cooled mortar and pestle ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were hybridized at 42 °C with 5 nM of a 5’-biotinylated oligonucleotide probe (Table S4) in ULTRAhyb Ultrasensitive Hybridization Buffer (Ambion) and then washed according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (ThermoFisher), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 × 106 KH2 ESCs were electroporated with 5 μg of pBS31–TetON plasmid and 5 μg of pCAGgs–FLPe plasmid using the Neon system (Invitrogen) with two impulses (20 ms ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Neuroscience 2019Quote: ... The following day sections were washed 5×5 in 0.1M PBS and incubated in goat-anti-mouse CY3 conjugated IgG (Invitrogen A32727) diluted 1:500 at room temperature for 1hr ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Biophysics 2019Quote: ... The protein was buffer exchanged 2-3x using either 7 kDa MWCO Zeba Columns for EC1-5/EC3-5 proteins or 40 kDa MWCO Zeba Columns for full length proteins (ThermoFisher).
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (5 µg) was combined with ERCC Spike-In Standards (5 µl of 1:50 diluted stock solution; Invitrogen) and submitted to the University of Minnesota Genomics Center for library generation and sequencing ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample was concentrated over an Acclaim PepMap C18 pre-column (5 μm particle size, 0.3 mm ID x 5 mm length, ThermoFisher Scientific) then bound to a 50 cm EasySpray C18 analytical column (2 μm particle size ...
-
bioRxiv - Immunology 2020Quote: Crosslinked samples were reconstituted in 5% FA/5% acetonitrile (ACN) and analysed in the Orbitrap Fusion Lumos Mass Spectrometer (ThermoFisher) coupled to an EASY-nLC 1200 (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... After the fourth EDTA incubation the pieces were cut into 2 mm2 pieces and placed in 5 mL digestion solution containing 5% fetal bovine serum (Gibco), 10 mM HEPES (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: To prepare the probe for hybridisation approximately 200-600ng of labelled probe DNA was ethanol precipitated with the 5 µg of sheared salmon sperm DNA and 5 µg of mouse or human Cot1 DNA (both from Invitrogen) and resuspended in hybridisation buffer (50% formamide ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...