Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Trichoplusia ni (Hi-5, Thermo Fisher Scientific) and Spodoptera fugiperda (Sf9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated with 5% goat serum (Thermofisher) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... while mouse monoclonal anti-claudin 5 (Invitrogen, Waltham ...
-
bioRxiv - Immunology 2024Quote: ... 5% CO2 in RPMI-1640 medium (Invitrogen) supplemented with 10% heat-inactivated defined FBS (HyClone Fisher) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... desalted on a C8 column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific), and separated on a C18 column (Acclaim PepMap ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 10 minutes and blocked with DPBS containing 5% BSA and 5% normal goat serum (Gibco), for 30 mins at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 pmol was 5’-end labeled with 20 μCi of Ψ-P32 ATP using Polynucleotide Kinase (Thermo Fisher) and subsequently purified using an Illustra MicroSpin G-50 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The montaged image in Figure 5 C ii and 5 C iii were generated by stitching together individual images using MAPS 1.1 software (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Microbiology 2023Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Microbiology 2023Quote: ... host cells at 37°C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic Calf serum (HyClone) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO] ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Microbiology 2024Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml leupeptin and 5 µg/ml E-64) and HALT phosphatase inhibitor (Thermo Fisher Scientific, Waltham, MA). Detergents were NP-40 or Brij 96V (both from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beas-2B cells were cultured at 37°C in a humidified atmosphere of 5% in serum-free 1× defined keratinocyte SFM Gibco) supplemented with 5 µg/mL gentamicin (Gibco). The medium was replaced every 2–3 days and cells were passaged every 4–5 days ...
-
bioRxiv - Microbiology 2022Quote: ... Health and Nutrition (Japan) and cultured at 37 °C with 5% CO2 in DMEM (WAKO) containing 5% fetal bovine serum (Gibco) and penicillin/streptomycin (100 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digests were allowed to stand for 5 min at room temperature and the supernatants were added to 5 ml of foetal bovine serum (FBS; Gibco) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Triton X-100 for 5 min and incubated with a blocking buffer containing PBS and 5% normal goat serum (31873; Invitrogen) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 400 rcf for 5 minutes and resuspended in cold flow cytometry buffer (calcium free HBSS with 5% fetal bovine serum (FBS, Gibco), 2 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... mice were woken up to allow any fecal matter to evacuate and then anesthetized again to introduce 100μL of Cy-5-labelled glucose or Cy-5 secondary goat anti-rat antibody (0.1mM diluted in PBS, ThermoFisher A10525) into the colon via a gavage needle enema ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... native gels were run with 5 μL per well of a 1:5:1 mixture of sample:water:BlueJuice loading dye (Thermo Fisher Scientific) in a 10% TBE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting cDNA was subjected to 5’ rapid amplification of cDNA ends (5’-RACE) with the use of a GeneRace Kit (Invitrogen) and with region-specific primers.
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...