Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for Mouse 20S Proteasome 20S PSM CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... 20% (v/v) Gibco horse serum (New Zealand origin, Life Technologies, USA), 100 mM HEPES-Na (pH 7.4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed with modified HEPES Buffer (20 mM HEPES buffer (Gibco) with 5 mM glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 1 mg/ml DiI stock (Thermo Fisher, Paisley, UK) was prepared in DMSO (Sigma Aldrich ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were loaded on a 4-20% Tris Glycine native gel (Invitrogen). Gels were run at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: Around 20 ovaries were dissected and homogenized in 1mL TRIzol (ThermoFisher #15596018) and total RNA was extracted following the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2022Quote: ... and subcloned into pCR-BluntII-topo vector (Life Technologies, cat# K2800-20). The T3 RNA polymerase recognition site (AATTAACCCTCACTAAAGGG ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plates were washed extensively with PBS containing 0.05 % Tween 20 (Fisher Scientific), incubated at room temperature for 2 hours in blocking buffer consisting of PBS supplemented with 10% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2022Quote: ... and preincubated with 250 µl of 20 µM of Hoechst 33342 (Invitrogen) in live cell medium for 22 min at 37 °C and 5 % CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 20 µl of 3 M sodium acetate pH 5.5 (Invitrogen, #AM9740) were then added to the tube ...
-
bioRxiv - Biochemistry 2022Quote: ... with a slit width of 20 eV and EPU (Thermo Fisher Scientific) for automated data collection ...
-
bioRxiv - Molecular Biology 2022Quote: ... dissolved in 80% distilled deionized water and 20% acetonitrile (ThermoFisher Scientific 85188) bringing the final concentration to 50 mM (2.5X that of DTT) ...
-
bioRxiv - Neuroscience 2022Quote: ... and supplemented with 20 ng ml−1 epidermal growth factor (EGF; Invitrogen) and 10 ng ml−1 fibroblast growth factor (FGF ...
-
bioRxiv - Immunology 2022Quote: ... Tissues were incubated in wash buffer (20% Formamide Ambion AM9342, 2× SSC) for 30-60 minutes and mounted with the hybridization mix ...
-
bioRxiv - Microbiology 2022Quote: ... The OD600 was measured using a spectrophotometer (Genesys 20, Thermo Fisher Scientific) or absorbance reader (PowerWave HT ...
-
bioRxiv - Cell Biology 2022Quote: ... 20 mM Imidazole) with 1mM PMSF and protease inhibitor tablet (Thermo Fisher). Lysates were centrifuged at 20,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were loaded on 4% to 20% Precise Protein Gels (ThermoFisher Scientific) and separated at 120 V for ~1 h in BupH Tris-HEPES-SDS running buffer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Zymosan Texas Red (ThermoFisher Z2843, 20 mg/ml in 1X PBS) were all performed at 4 dpf ...
-
bioRxiv - Neuroscience 2019Quote: ... and digested by 0.25% trypsin (20 minutes at 37°C; Life technologies) in HBSS ...
-
bioRxiv - Developmental Biology 2021Quote: ... supplemented with 20% KnockOut Serum Replacement (KSR) (Cat. 10828028, Thermo Fisher Scientific), non-essential amino acids ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were incubated in wash buffer (20% Formamide Ambion AM9342, 2× SSC) for 15 minutes (for forzen sections ...
-
bioRxiv - Neuroscience 2021Quote: ... a mixture of 1μl of oligo(dT)20 (50 μM) (Invitrogen; 18418020), 2 μg total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was extracted from 15-20 mg of BAT with TRIzol (Invitrogen) and chloroform and precipitated with isopropanol ...
-
bioRxiv - Microbiology 2021Quote: ... Extracted RNA (20 μL) was treated with 2U TURBO DNase (ThermoFisher Scientific), further purified using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with lysozyme (20 mg/ml) (Thermo Fisher Scientific, Grand Island, NY). The suspension was incubated at 37°C for 1 h with occasional agitation ...
-
bioRxiv - Neuroscience 2021Quote: Doxycycline hydrochloride (Dox, 20 mg/ml; Fisher Scientific BP2653-5, Pittsburgh, PA) was dissolved in 3% sucrose and provided ad libitum for 8 days pre-injury and for 8-21 days starting 6 weeks post-injury ...
-
bioRxiv - Plant Biology 2021Quote: ... the protoplasts were incubated with 20 nM MitoTracker® Orange CMXRos (ThermoFisher) to fluorescently label the mitochondria.
-
bioRxiv - Neuroscience 2021Quote: ... 20 μg lysates were incubated overnight with NeutraAvidin agarose beads (Thermo Scientific) and then were washed with lysis buffer four times ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.01% Tween-20 (wt:wt)] containing CountBright Absolute Counting Beads (Thermo Scientific). Beads were analyzed using flow cytometry on a FACSAriaIII instrument (BD Biosciences).
-
bioRxiv - Microbiology 2021Quote: ... The sections were pre-treated with 20 μg/ml Proteinase K (Ambion) in PBS for 15 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... slides were then stained for 20 min with JOJO-1 (Life Technologies) and mounted with with Fluoromount-G (Southern Biotech) ...
-
bioRxiv - Neuroscience 2020Quote: ... 15 μl of R2 20 μm POROS beads slurry (Life Technologies Corporation) were added to the sample followed by a 3-hour incubation at 4°C on a shaker ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 mM DTT) and separated by SDS-PAGE on gradient gels (Invitrogen). Proteins were transferred to nitrocellulose membranes (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... Pooled fractions were applied to a Poros 20 HE column (Applied Biosystems) equilibrated in buffer D + 0.1 mM EDTA at 0.15 M KCl ...
-
bioRxiv - Biochemistry 2020Quote: ... the remaining gel was stained for 20 mins in SyBrGold (Invitrogen™) and visualized by UV transillumination ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sectioned at 20 μm on a cryostat (ThermoFisher CryoStart NX70). Images were acquired using a Leica SP8 laser point scanning confocal microscope,10X ...
-
bioRxiv - Neuroscience 2022Quote: ... permeabilized and blocked for 20 minutes in Horse serum (4%, ThermoFisher, 16050114), Triton X-100 (0.3% ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were electrophoresed with NovexTM 10-20% Tricine Gel (Thermo SCIENTIFIC, USA) at 200 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... Cryosections (20 μm) were affixed onto Superfrost plus charged slides (Fisher Scientific) and sections preprocessed following the RNAscope technical note (TN 320534 ...
-
bioRxiv - Biochemistry 2022Quote: ... 80 U of RNase inhibitor (20 U/µL, AM2696, Thermo Fisher Scientific), 0.8 µL of ß-mercaptoethanol (21985023 ...
-
bioRxiv - Biochemistry 2022Quote: ... and 100 U of RNase inhibitor (20 U/µL, Thermo Fisher Scientific)) for 30 min on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... and 50 μg proteinase K (20 mg/mL, AM2548, Thermo Fisher Scientific) were added to each sample and incubated for 30 min at 50 °C (with shaking) ...
-
bioRxiv - Immunology 2022Quote: ... 20 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... and/or HA-WDR-20 (2 μg DNA) using Lipofectamine 2000 (Invitrogen). 24 hours post-transfection the cells were again split into 12-well plates at 100,000 cells per well for cycloheximide time course studies ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 20 A second lot of cryopreserved primary human hepatocytes obtained from ThermoFisher Scientific was used for the drug pharmacokinetics (PK ...
-
bioRxiv - Microbiology 2019Quote: ... 20 and 25 °C in 100-microwell plates (Honeycomb, Thermo Fisher, USA). Wells were randomised in duplicate on the plate with negatives included ...
-
bioRxiv - Microbiology 2019Quote: ... LB medium was supplemented with chloramphenicol (Acros Organics; 20 µg ml-1) as needed.
-
bioRxiv - Neuroscience 2019Quote: ... were coated with 20 µg/mL Laminin (Invitrogen, cat. no. 23017-015) for 2 hours at 37°C and rinsed with Neurobasal medium.
-
bioRxiv - Microbiology 2021Quote: ... where roots were washed again with 0.1% tween 20 (ThermoFisher Scientific, USA) and deionized water ...