Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and passaged every 3-4 days using Gibco TrypLE Express (ThermoFisher). For imaging ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Developmental Biology 2023Quote: ... we slowly injected 0.5-1 μL rAAV (about 1∼3×109 genome copy (GC)) mixed with Chicago Sky Blue dye (0.1%, Fisher Scientific, Cat # AAA1424214) into the oviduct ampulla using a glass micropipette with tip diameter of ∼10-30 μm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lungs were dissected and placed in ice cold FACS buffer (1% BSA, 3% FBS, 96% Ca2+ and Mg2+ free PBS) with 1 μg/ml Actinomycin D (ThermoFisher BP606-5). After isolation ...
-
bioRxiv - Cell Biology 2023Quote: ... were seeded on the top of the membrane and cultured for 3 days in DMEM/F12 (1/1) supplemented with 5 % fetal bovine serum (Fetal Clone II; Hyclone, Thermo Scientific, France), 0.2 ng/ml EGF (Gibco) ...
-
bioRxiv - Systems Biology 2019Quote: The 72 fractions obtained from the OG fractionation (3 TMT x 24 fractions) were loaded on a trap nanocolumn (0.01 x 2 cm, 5 μm; Thermo Fisher Scientific, Massachusetts, USA) and separated with a C-18 reversed-phase (RP ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Systems Biology 2023Quote: ... 30 s at 72 °C and a final step of 7 min at 72 °C using a GeneAmp 2400 (Applied Biosystems, Foster City, CA, USA) thermal cycler ...
-
bioRxiv - Immunology 2020Quote: ... Tissue sections were then stained with DAPI (Thermo Fisher Scientific, USA, 1:5000, 5 min at 37°C) with subsequent mounting with Prolong Diamond Antifade mountant (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: THP-1 cells (ATCC, TIB-202) were cultured at 37°C with 5% CO2 in RPMI 1640 (Invitrogen) supplemented with 10% heat inactivated FBS (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Between 1 and 5 μg of RNA was boiled at 95 °C with Gel II Loading Buffer (Invitrogen) and loaded on a urea-PAGE gel (Sequagel ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 1-3h at 37°C in a HERAcell 150i or 160i 5% CO2 incubator (Thermo Fisher Scientific). Cells were washed in 1x PBS and fixed in 10% neutral buffered formalin (HT501128 ...
-
bioRxiv - Immunology 2022Quote: ... cells were stained for 1 hour at 37°C/5% CO2 with 1μM CellTracker Deep Red (Invitrogen, C34565) and 1 drop/mL NucBlue Live ReadyProbes Reagent (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... incubated for 10 min in the dark at room temperature with FM 4-64FX (3 μg ml-1) (ThermoFisher). Cells were applied to a 5% agarose pad containing M9 minimal media with glucose (0.4%) ...
-
bioRxiv - Genetics 2022Quote: Immunoprecipitations were performed using 1 μg of Anti-Trimethyl-Histone-3-Lys-4 (-Thermo Fisher Scientific; catalog# PA5-17420) overnight at 4 ◦ C ...
-
bioRxiv - Neuroscience 2022Quote: 100 to 150 3-dpf zebrafish larvae were bathed in Yo-Pro-1 (4 µM, 30 min) (Invitrogen, Y3603), then washed 3 times in blue water to label lateral line hair cells ...
-
bioRxiv - Immunology 2023Quote: ... and packaging vector psPAX2 were mixed in a 4:3:1 ratio in OPTI-MEM (Thermo Fisher Scientific, 31985070) and PEI (Polysciences ...
-
bioRxiv - Immunology 2023Quote: ... 20 ng ml-1 GM-CSF (Biozym) or X38-Ag8 supernatant (1%) and from day 5 on additionally with 10 ng ml-1 IL-4 (Life technologies). At day 7 ...
-
bioRxiv - Genomics 2023Quote: ... plugs were washed 4 times in 1×Wash Buffer (BNG) and 5 times in 1× TE Buffer (ThermoFisher Scientific, Waltham, MA). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) or FxCycle™ PI/RNase Staining Solution (Thermofisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-aminoactinomycin D (7-AAD, Thermo Fisher, A 1310) was added 1:50 as a cell death marker.
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Systems Biology 2019Quote: Liver endothelial cells were incubated for 1 h at 37°C with 1 µM Fura-2 AM (Thermo Fisher Scientific, USA) and 0.1% pluronic acid in Standard Bath Solution (SBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... the heads were dissected and fixed overnight at 4°C using 4% paraformaldehyde (Thermofisher, Cat#: J61899-AP). After several washes the heads were incubated in 20% Sucrose (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were fixed for 30 minutes at 4°C with 4% paraformaldehyde in PBS (Thermo Fisher Scientific), briefly washed three times ...
-
bioRxiv - Plant Biology 2019Quote: ... coli or One Shot™ ccdB Survival™ 2 T1R Competent Cells (ThermoFisher Scientific). Depending on the selectable marker ...
-
bioRxiv - Plant Biology 2022Quote: ... Vectors were transformed into Escherichia coli One Shot OmniMAX 2 T1 (ThermoFisher Cat# C854003). CRISPR-Cas9 expression vectors carrying gRNA_W or gRNA_F were transformed in Agrobacterium tumefaciens (GV3101) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µM PAGE-purified primers and one unit of Platinum Taq DNA polymerase (Invitrogen). qPCR signal from a mock control lacking antibody was measured to determine the efficiency of recruitment ...
-
bioRxiv - Neuroscience 2024Quote: ... The ribosomal pellet was resuspended in 600 µl of 10 mM Tris pH 7 (prepared from 1 M Tris pH 7, Ambion) and stored at –80 °C until all samples for each tissue type were processed until this step.
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 15-20 pooled day 30 neurospheres and 5-7 pooled day 60 organoids using TRIzol (Invitrogen; Thermo Fisher Scientific Inc. ...