Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The spike probes were purified with HisPur Ni-NTA Resin (Thermo Fisher) as described in the Protein purification section ...
-
bioRxiv - Genomics 2019Quote: ... We added External RNA Control Consortium (ERCC) spike-in controls (Life Technologies) to one microgram of total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.15 μL ERCC RNA Spike-In Mix (100.000x diluted) (Thermo Scientific, 4456740), 0.15 μL nuclease-free water (NF H2O ...
-
bioRxiv - Microbiology 2020Quote: ... Spike cDNA was produced from the total RNA using superscript iii (ThermoFisher) with specific RT-primers (CAATTGTGAAGATTCTCATA) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.4 ng spike-in mix was added into the TRIzol (ThermoFisher, 15596018) cell lysis to eliminate technical errors retained during the steps of biotinylating ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 1:4,000,000 dilution of ERCC spike-in transcripts (Life Technologies, #4456740) was added to each sample ...
-
bioRxiv - Immunology 2021Quote: ... NVX-CoV2373 Spike protein was coated on Maxisorp ELISA plate (Thermo Fisher), and then blocked with 5% BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... we included Spike-In Mix 1 (1:1000; Life Technologies, Cat# 4456740), as from the Fluidigm manual ...
-
bioRxiv - Microbiology 2021Quote: ... Commercially available polyclonal IgG anti-Spike protein antibody (Thermo Fisher, MA5-35949) or anti-fd bacteriophage antibody (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Immunology 2020Quote: ... External RNA controls consortium (ERCC) RNA spike-in mixes (Thermo Fisher, 4456740) were included for quality assurance ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1 μl ERCC RNA Spike-In Mix (107 dilution, #4456740, ThermoFisher). After briefly spinning ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... 1 μL of 1:200 ERCC RNA Spike-In Mix (Invitrogen, 4456740) was added to each fraction pool and concentration was measured again ...
-
bioRxiv - Cancer Biology 2021Quote: ... External RNA Controls Consortium (ERCC) ExFoldRNA Spike-in Control Mixes (Invitrogen #4456740) (4 μL/sample ...
-
bioRxiv - Immunology 2020Quote: RBD and spike trimer proteins were purified with HisPur NiNTA resin (ThermoFisher). Prior to purification ...
-
bioRxiv - Genomics 2021Quote: ... Spike-in controls were mixed in (Ambion-ERCC Mix, Cat no. 4456740) and Illumina sequencing libraries were made using the RNA TruSeq Stranded total RNA (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Neuroscience 2023Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Bioengineering 2023Quote: ... an equal amount of ERCC RNA Spike-In Mix (ThermoFisher, Cat #4456740) was added to the total RNA extracted from cell number-normalized H1 samples using the recommended dilution ratio before library preparation ...
-
bioRxiv - Immunology 2022Quote: ... and the Wuhan spike protein was purified using Talon Resin (Thermo Scientific) while the D614G VFLIP spike was purified on a StrepTrap XT column (GE Healthcare) ...
-
bioRxiv - Genomics 2024Quote: ... either a 1% dilution of ERCC RNA Spike-In Mix (4456740, ThermoFisher) or fully concentrated samples were processed into a short-read libraries using the TruSeq Stranded mRNA Sample Prep Kit from Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... the strips were washed 3 times in PBS-T before incubation in primary antibody (GST Tag Mouse anti-Tag, Clone: 8-326, Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: Genes encoding the full-length sequences of Human PP2A A subunit and PP2A C subunit with N-terminal His tag and non-cleavable HA tag were sub-cloned into the pFastBac-Dual vector (Invitrogen). Sequences of PP2A A and C subunits are shown in Table 1 ...
-
Lactic Acid Containing Polymers Produced in Engineered Sinorhizobium meliloti and Pseudomonas putidabioRxiv - Microbiology 2019Quote: ... the gel was used for His-tag staining following the InVision(tm) His-tag In-Gel Stain protocol provided by Invitrogen.
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Biochemistry 2022Quote: ... with a C-terminal Strep tag for purification and a foldon tag for trimerization was inserted into the pFastBac-Dual vector (Invitrogen) and was expressed using Bac-to-Bac baculovirus system (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... with a C-terminal Strep tag for purification and a foldon tag for trimerization was expressed in FreeStyle 293-F cells (Invitrogen). The plasmid was transiently transfected at a density of 2 × 106 cell per ml using polyethyleneimine (PEI ...
-
bioRxiv - Microbiology 2022Quote: ... A recombinant SPATR (rSPATR) fused to a polyhistidine tag (His-tag) was produced in BL21-CodonPlus-RIL competent cells (Invitrogen) and protein purification was performed under denaturing conditions using Ni-NTA Agarose (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... ORFs were cloned in pDEST15 (containing the GST tag) and pDEST17 Gateway (containing the His6 tag) vectors (Thermo Fisher Scientific). For Y2H assays ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length mouse GPR158 containing an N-terminal HA-tag or smURFP-tag were cloned into pcDNA3.1 (Thermo Fisher Scientific). Full-length cDNA encoding mouse PLCXD2 containing a C-terminal FLAG-tag in pcDNA3.1 (clone OMu06191 ...
-
bioRxiv - Molecular Biology 2019Quote: 2.5D-Fc and 2.5F-Fc fusions were labeled with the succinimidyl ester derivative of Alexa Fluor 488 (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed with FC buffer and resuspended in FC buffer including viability die and analyzed on Attune (Thermofisher Scientific). The permeabilized cells were excluded from the analysis due to intracellular staining.
-
bioRxiv - Bioengineering 2023Quote: ... Bound SiRPα-Fc was detected with a secondary biotinylated rabbit anti-IgG Fc monoclonal antibody (Thermo Fisher Scientific) followed by HRP-conjugated streptavidin (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotin labelling of the nucleosome assembly was conducted using the EZ-Link™ Psoralen-PEG3-Biotin kit (Thermo Scientific™) as described in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were washed twice with ice-cold PBS and treated for 30min with 0.6 mg/ml of biotin in PBS (EZLink Sulfo-NHS-LC-Biotin, Thermo Scientific). Next ...
-
bioRxiv - Neuroscience 2022Quote: ... the neurons were washed with cold PBS (all wash steps were carried out with PBS supplemented with 1 mM CaCl2 and 0.5 mM MgCl2) and incubated with 1 mg/ml biotin (EZ-Link™ Sulfo-NHS-Biotin, ThermoFisher), shaking ...
-
bioRxiv - Molecular Biology 2020Quote: ... Biotin was attached to cross-linked RNA duplexes by incubating with 150 µM Click-IT Biotin sDIBO Alkyne (Life technologies) under constant agitation at 37 °C for 1.5 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Click-chemistry reaction for protein detection was performed using biotin alkyne (PEG4 carboxamide-propargyl biotin) according to manufacturer’s instructions using the Click-iT™ Protein Reaction Buffer Kit (Invitrogen). Labeled proteins were separated by SDS-PAGE ...
-
bioRxiv - Biophysics 2022Quote: Biotinylated-BtuF* described in previous section was tethered to the surface of a quartz microfluidic flowcell that was pre-functionalized with polyethylene glycol (PEG)/biotin-PEG (mPEG-SVA MW3400 and Biotin-PEG-SVA MW5000, respectively, Laysan Bio) and pre-derivatized with streptavidin (ThermoFisher) via a streptavidin-biotin-streptavidin bridge52,53 ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 µl of freshly prepared solution of Biotin tracer (10 mg/ml EZ-Link Sulfo-NHS-LC-Biotin, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... The mole-to-mole ratio of biotin to protein was quantified using the Pierce Biotin Quantitation Kit (Thermo Fisher Scientific). Biotinylated Spike was conjugated to streptavidin-FITC (BioLegend ...
-
bioRxiv - Molecular Biology 2024Quote: ... CTG Hairpin-Biotin and GC Clamp-Biotin were bound to Streptavidin Magnetic Beads (Dynabeads® M-280 Streptavidin, Life Technologies) with a 50 nM final concentration of biotinylated antigen for the first round and 10 nM final concentration of biotinylated antigen for the second and third rounds.
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... HEK293 and PLC/PRF/5 cells were cultured in MEM GlutaMAX™ (Gibco). All media were supplemented with 10% Fetal Bovine Serum (HyClone) ...
-
bioRxiv - Cell Biology 2019Quote: ... Positively transfected cells (HEK293) were selected with hygromycin B (Cat.10687010, Thermo Fisher), seeded in 24-well plates at a density of 20,000 cells/well ...
-
bioRxiv - Neuroscience 2019Quote: Human embryonic kidney (HEK293) cells were maintained in Dulbecco’s modified eagle medium (Gibco) containing 10% fetal bovine serum (HyClone) ...
-
bioRxiv - Genetics 2019Quote: ... The HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (Life Technologies, Inc.) with 10% fetal bovine serum (Hyclone) ...
-
bioRxiv - Genomics 2020Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, Grand Island, NY) with 10% (v/v ...