Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... using the ZIKV-F2 (5’-CAGCTGGCATCATGAAGAATC-3’) and ZIKV-R1 (5’-CACTTGTCCCATC TTCTTCTCC-3’) primers for African strain detection (ThermoFisher SCIENTIFIC) or the ZIKV-F1 (5’-CAGCTGGCATCATGAAGAACC-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences cutting near genomic loci of MLL3 Y4792 (5’-ACTATGGTCATCGAGTACAT-3’) and MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) were synthesized by Thermo Fisher’s custom in vitro transcription service ...
-
bioRxiv - Plant Biology 2021Quote: The IKU2 promoter was amplified using the primers Prom-IKU2-B4 (5’-ggggacaactttgtatagaaaagttgGGTCTCTCTTGATAACGATTTG-3’) and Prom-IKU2-B1R (5’-ggggactgcttttttgtacaaacttgTGTTCTCTACGTCGGAAGG- 3’) and cloned into pDONR-P4-P1R (Life Technologies). A triple LR Gateway reaction (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was done on1 uL of cDNA using 10 µM of forward and reverse primers (Fw 5’-AAGATTCTCCTGAGCTGGGTC −3’ and Rv 5’-AGTCACTTTAGGTGGCCTTGG −3’, Life technologies) and 1 U Taq DNA polymerase (10342 ...
-
bioRxiv - Immunology 2020Quote: ... or equimolar mix of two human APOBEC3A siRNAs (Silencer 45715 and 45810, respectively, with sense sequences 5’-GACCUACCUGUGCUACGAATT-3’ and 5’-GCAGUAUGCUCCCGAUCAATT-3’, Life Technologies) using Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... or with a pool of two different USP30 siRNAs (D1: 5’-CAAAUUACCTGCCGCACAA-3’; D3, 5’-ACAGGAUGCUCACGAAUUA-3’, Dharmacon; siUSP30) by using Lipofectamine RNAiMAX (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... and human Oct 4 (For: 5’-CTTGCTGCAGAAGTGGGTGGAGGAA-3’/Rev: 5’-CTGCAGTGTGGGTTTCGGGCA-3’) PCRs were conducted using an ABI 7300 Real Time PCR System (Applied Biosystems). PCR cycling conditions were 95° C for 10 min. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Immunology 2021Quote: ... against the IAV nucleoprotein (forward: 5’-CAGCCTAATCAGACCAAATG-3’; reverse: 5’-TACCTGCTTCTCAGTTCAAG-3’) were assayed using SYBR Green Master Mix (Applied Biosystems) to confirm viral presence in the maternal lung.
-
bioRxiv - Genetics 2020Quote: ... mouse cDNA was amplified with primers (F: 5-gtttatgggcctcaacctcatg-3, R: 5-caggcttcactccagctttttgg-3) and then enzyme digested with BsiEI (Thermofisher #FD0894). Genotyping result using this method is shown in Fig ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... GAPDH-F (5’-GGA GCGAGATCCCTCCAAAAT-3’) and GAPDH-R (5’-GGCTGTTGTCATACTTCTCATGG-3’) using Power SYBR Green PCR Master Mix (Applied Biosystems). All reactions were carried out on the StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and CYPBΔPSI (forward 5′ CGAACTTGTGTTTGGTGGTGTT-3′ and reverse 5′-GCCTTTTTCAGTCACCGGAACA-3′) primers on a StepOnePlusTM Real-Time PCR System (Applied Biosystems, USA) as previously described (Muthusamy et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...
-
bioRxiv - Genomics 2020Quote: ... The 16S rRNA gene was amplified from the extracted genomic DNA using 16S universal primers 27F (5’-AGA GTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTTC-3’) and sequenced using an automated ABI3730XL capillary DNA sequencer (Applied Biosystems, USA) for taxonomic identification at Cosmo Genetech (Seoul ...
-
bioRxiv - Microbiology 2020Quote: ... 229E-RP reverse primer (5’-CCAACACGGTTGTGACAGTGA-3’) and the TaqMan minor groove binder (MGB) probe 229E-TP (FAM-5’-TCCTGAGGTCAATGCA-3’-NFQ-MGB; Thermo Fisher Scientific), derived from the HCoV 229E membrane protein gene sequence as described previously (Vijgen et al. ...
-
bioRxiv - Microbiology 2021Quote: The mcr-1 gene was amplified from the clinical isolate ESBL20150072 (European Nucleotide Archive, accession number; SAMEA104060671) using primers: 5’-TTTTGGATCCCGGTTTTCGGGCTTTTTA-3’ and 5’-ATATGTCGACTCAGCGGATGAATGCGGT-3’ and Phusion polymerase (Thermo Fisher Scientific). PCR product was digested with BamHI and SalI and ligated into pACYC184 digested with the same enzymes (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Genetics 2022Quote: ... 5’-GGCAAGCUGACCCUGAAGUdTdT-3’ / 5’-ACUUCAGGGUCAGCUUGCCdTdT-3’ or with a hsa-miR-34a mimic duplex: 5’-P-UGGCAGUGUCUUAGCUGGUUGUU-3’ / 5’-P-CAAUCAGCAAGUAUACUGCCCUA-3’ according to the protocol for Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... a fragment containing 2.21 kb upstream regulatory region of ELF3 was amplified from Col-0 genomic DNA using primers ELF3Prom-Fw (5’-CACCCTTATAAATAAAATTCC-3’) ELF3Prom-Rv (5’-CACTCACAATTCACAACCTTTTTC-3’) and cloned into the Gateway System (pENTR™ Directional TOPO® Cloning kit, Invitrogen) to obtain the pELF3-TOPO plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Drosophila dSF2 sequence was PCR amplified (dSF2 F 5’-CACCATGGGATCACGCAACGAGTGCCG-3’ and dSF2 R 5’- ATAGTTAGAACGTGAGCGAGACCTGG-3’) was cloned into pEntry-TOPO vector (Thermo Fisher Scientific). The pENTR-dSF2 vector was recombined with Gateway plasmid pTWH (Drosophila Genomics Resource Center ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Expression of Kdm5c was detected us-ing the primers 5’-CCCATGGAGGCCAGAGAATAAG-3’ 5’-CTCAGCGGATAAGAGAATTTGCTAC-3’ and nor-malized to TBP using the primers 5’-TTCAGAGGATGCTCTAGGGAAGA-3’ 5’-CTGTGGAGTAAGTCCTGTGCC-3’ with the Power SYBR™ Green PCR Master Mix (ThermoFisher #4367659).
-
bioRxiv - Cancer Biology 2024Quote: ... sequence is 5’-GCCGACCAAUUCACGGCCG-3’ and siRNA directed against GNA11 (siGNA11) is 5’-AAAGGGUACUCGAUGAUGC-3’) using Lipofectamine™ RNAiMAX (13778150, Fisher Scientific) and harvested 48 h post-transfection.
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Cell Biology 2020Quote: ... and TERT were inserted into the entry vector via a BP reaction (Invitrogen, Carlsbad, CA). These segments were then recombined with CSII-TRE-Tight-RfA through an LR reaction (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... N/Tert-1 cells were transfected utilizing lipofectamine 2000 (according to manufacturer’s instructions, ThermoFisher Scientific). 24-hours post transfection cells were washed and noted cells were supplemented with 15µM 17β-estradiol ...
-
bioRxiv - Cancer Biology 2020Quote: ... All N/Tert-1 cells were grown in keratinocyte serum-free medium (K-SFM;Invitrogen) with a 1% (vol/vol ...
-
bioRxiv - Cell Biology 2023Quote: N/TERT-2G keratinocytes were electroporated using the NEON transfection system 10µL kit (ThermoFisher Scientific). N/TERT-2G keratinocytes were detached from culture plastic and washed twice with dPBS (without Ca2+ and Mg2+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... internal controls (human Tert) and FGFR2 or MYC target gene probe (Thermo Fisher Scientific #4400292). Reactions were run on the QuantStudio 6 or 7 (ThermoFisher Scientific ...