Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Plant Biology 2024Quote: ... Cells were disrupted by passing them 3-5 times through a French press (Thermo Fisher) and centrifuged for 50,000g for one hour at 4°C ...
-
bioRxiv - Genetics 2024Quote: Cell pellets (1 x 10^5 – 3 x 10^6) were washed with PBS (Gibco), resuspended in RLB (10 mM Tris pH 7.5 ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Biophysics 2021Quote: ... Protein samples (12 μL) were mixed with 3 μL 5 M DTT and 5 μL 4x NuPAGE™ LDS sample buffer (Thermo Fisher Scientific) and incubated (95 °C ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 3.5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Immunology 2022Quote: ... Human N/TERT-1 keratinocytes (a kind gift of James Rheinwald, Harvard Medical School) were cultivated in Keratinocyte serum-free medium (Thermo Fisher Scientific) supplement with 0.5x bovine pituitary extract (BPE) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Telomerase-immortalized human neonatal foreskin keratinocytes (N-TERTs) (21) were cultured in EpiLife medium containing human keratinocyte growth supplement (HKGS) (Thermo Fisher Scientific) and penicillin/streptomycin ...
-
bioRxiv - Microbiology 2021Quote: Primary HFFF immortalised with human telomerase (HFFF-TERTs) (96) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific, Lutterworth, UK) supplemented with 10 % foetal bovine serum (v/v ...
-
bioRxiv - Genetics 2024Quote: ... S1F/TERT-1 and Mel-ST cell lines were electroporated with ribonucleoprotein complex via Neon™ Electroporation System (Thermofisher Scientific, Massachusetts, USA). To maximize the genome-editing efficacy ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Flag plasmids were transiently transfected in to N/Tert-1 cells using Lipofectamine™ RNAiMAX transfection (Invitrogen, catalog no. 13778-100) protocol and transfected in to U2OS cells using the calcium phosphate transfection protocol.
-
bioRxiv - Cell Biology 2024Quote: SYTL5 was amplified from WT U2OS cDNA (5’-ATGTCTAAGAACTCAGAGTTCATC-3’ and 5’-TTAGAGCCTACATTTTCCCATG-3’) and cloned into Zero Blunt TOPO vector using Zero Blunt™ TOPO™ PCR Cloning Kit (Thermo Fisher Scientific #450245) according to the manufactureŕs instructions ...
-
bioRxiv - Immunology 2024Quote: ... and OtsuR747 (5’- TATGCCTGAGTAAGATACGTGAATGGAATT-3’) primers (IDT, Coralville, IA) and detected with the probe OtsuPr665 (5’-6FAM- TGGGTAGCTTTGGTGGACCGATGTTTAATCT-TAMRA) (Applied Biosystems, Foster City, CA) by SsoAdvanced Universal Probes Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed with PBS 3-5 times for 5 minutes each and mounted with ProLong Gold Antifade Mountant (#P36930, Thermo Fisher Scientific, Waltham MA). Confocal images were taken with the 20x and 40x (oil ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-sense, 5’ AAGAGGUUUAGCUGGUAC CTT 3’) or control nontargeting siRNA (Genepharma, Shanghai) using Lipofectamine RNAiMAX (Invitrogen). Six hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Samples were injected onto a Biobasic AX LC column (5 μm, 50 × 3 mm; Thermo Scientific). The mobile phase consisted of 100 mM ammonium carbonate (A ...
-
bioRxiv - Genomics 2020Quote: ... and fragmented by heating at 94 °C for 3 min in 5× First Strand Buffer (Invitrogen). The fragmented mRNAs were reversely transcribed into cDNA by SMARTScribe reverse transcriptase (TaKaRa) ...
-
bioRxiv - Cancer Biology 2020Quote: The 3’ & 5’RACE products were cloned using TOPO TA Cloning Kit (Invitrogen, Cat #K4530-20), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... passage 3 fibroblasts were trypsinized 5 min at 37°C using 0.05% trypsin with EDTA (Gibco), centrifuged at 1000 rpm for 5 min at RT and resuspended in HBSS (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... DM-3 and RS-5 cells were cultured in NCTC-109 medium (Gibco, Carlsbad, CA, USA) supplemented with antibiotics ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Genomics 2020Quote: ... commercially available CRISPR control targeting HPRT (IDT) and KANK1 exon-targeting (ThermoFisher Scientific, 5’-GUCUAGUUGAUAACCAUAGG-3’) gRNAs were also obtained ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Coverslips were washed 3 x 5 minutes in PBST and then incubated with secondary antibodies (Invitrogen) diluted in PBST + 0.2% BSA for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: A 3 or 5 wt% solution of GelMAL was prepared by dissolving GelMAL in PBS (Gibco Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 × 5 min with TBS and embedded in ProLongTM Gold Antifade Mountant (Thermo Fisher Scientific). Images were taken with a Nikon Eclipse90i microscope and acquisition was performed with the NIS Elements software (Version 5.01) ...