Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and tert-butyl hydrogen peroxide (ThermoFisher) were used as standards for the extra- and intracellular assays ...
-
bioRxiv - Microbiology 2023Quote: ... tert-Butyl hydroperoxide (tBOOH – Acros Organics) and diamide (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Tert-Butyl hydroperoxide (TBT) (Acros Organics) was used as a positive control to induce oxidative stress.
-
bioRxiv - Cell Biology 2024Quote: ... 3) Oxidative stress induction using 70 μM tert-Butyl hydroperoxide (Thermo Fisher 180345000) for 16-18 h ...
-
bioRxiv - Bioengineering 2022Quote: ... di-tert-butyl dicarbonate (Boc2O, 99%, Fisher Scientific) (1.6:1 to HA-TBA repeat unit ...
-
bioRxiv - Immunology 2021Quote: ... tert-butyl hydrogen peroxide was obtained from ACROS Organics; Oxidized and reduced L-Glutathione were obtained from Alfa Aesar ...
-
bioRxiv - Immunology 2023Quote: ... Di-tert-butyl peroxide (DTBP) crosslinker (#20665, Thermo Fisher Scientific) was added for 5 minutes at 37 °C to a final concentration of 2.5 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... Methyl tert-butyl ether (MTBE) was acquired from Acros organics [3787 20010] and acetonitrile was from Honeywell Riedel-de Haën [348512.5L].
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Cell Biology 2024Quote: ... treating cells with either 400 µM tert-butyl hydroperoxide (TBHP; C10493A, Invitrogen) or 5 mM N-acetyl-L-cysteine (NAC ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM disuccinimidyl suberate (DSS) or 2 mM tert-butyl disuccinimidyl phenyl phosphonate (tBu-PhoX)(Thermo Fisher Scientific) in DMSO was added to the solution and incubated for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Tert-butyl hydroperoxide (TBHP, 70% solution in water) was obtained from Acros Organics and diluted in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The crude peptide was precipitated in tert-butyl methyl ether (TBME, ACROS Organics, AC378720025). After the supernatant was removed by centrifugation ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Biochemistry 2020Quote: ... N,N-dimethyl formamide (DMF) and water and HPLC grade methyl tert-butyl ether (MTBE) were obtained from Thermo Fisher used throughout ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The lysate was then further decolorized by gently shaking against an equal volume of Methyl tert-Butyl Ether twice and then Hexanes (Fisher Scientific). The aqueous layer was then recovered ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Cell Biology 2022Quote: ... TERT (ThermoFisher #Bt03239211), and CDK4 (ThermoFisher #Bt03231354) ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2024Quote: ... TERT immortalisation was maintained in the presence of 5 µg/ml of Hygromycin (Invitrogen, 10687-010). Cells transduced with lentiviruses were maintained in media supplemented with 1 µg/ml Puromycin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TERT TaqMan Assay (Applied Biosystems, Hs00972650_m1) were used to measure TERT expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... or TERT (Applied Biosystems, cat. no. 4403316) as the reference assay ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction was monitored using an Agilent 1100 HPLC system equipped with a MAbPac HIC-Butyl column (4.6 × 100 mm, 5 µm, Thermo Scientific). Elution conditions were as follows ...
-
bioRxiv - Bioengineering 2020Quote: ... was analyzed using an Agilent 1100 HPLC system equipped with a MAbPac HIC-Butyl column (4.6 × 100 mm, 5 µm, Thermo Scientific). Elution conditions were as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... and butylparaben (Butyl 4-hydroxybenzoate, BP; Acros Organics, CAT: 403571000). Chemicals were dissolved in ethanol (EtOH ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Biophysics 2024Quote: ... RPTEC-TERT cells were cultured at 37°C with 5 % (v/v) CO2 and humidity in DMEM/F12 (Fisher Scientific, 11330-032) supplemented with RPTEC growth kit (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...