Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... The relative expression of each target was calculated using the relative quantification method (2-ΔΔCT) with RNA18S (5’-TGTGGTGTTGAGGAAA-GCAG-3’ and 3’-TCCAGACCATTGGCTAGGAC-5’; Invitrogen) as internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK and N/TERT-2G keratinocytes were cultured in EpiLife media (Life Technologies) supplemented with Human Keratinocyte Growth Supplement (HKGS S0015 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and IMR-90 tert (human lung fibroblast) cells were cultured in DMEM (Gibco), supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) by colony PCR (Vaishnava et al., 2011) using DreamTaq Master Mix (ThermoFisher Scientific) and 0.2μM primers ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... using the oligonucleotides WPRE-F 5’-TGCTTCCCGTATGGCTTTCAT-3’ and WPRE-R 5’-CAGCAAACACAGTGCACACC-3’ as primers and SYBR Select Master Mix (ThermoFisher Scientific). The measurements were performed with a CFX384 instrument (Biorad ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Genomics 2020Quote: ... using forward primer (5’-TGATTATCGACATCCCGTCA-3’) and reverse primer (5’-GTCTGGAATCTCATAGGTAG-3’) and run on an ABI 7500 thermocycler (Applied Biosystems). Primer specificity and capture temperature were determined by melt curve analysis ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Microbiology 2021Quote: ... Resulting colonies were screened for plasmid presence by PCR of a portion of the pESC-URA-lpt1 plasmid (Forward primer: 5’-TTGGAAACAGCTCCAAATCC-3’, Reverse primer: 5’ CCCAAAACCTTCTCAAGCAA-3’; ordered from ThermoFisher Oligos) and preserved as glycerol stocks.
-
bioRxiv - Developmental Biology 2022Quote: ... were retrotranscribed from either 5’-CATGCTGCTGGTGGGTGTGCT-3’ or 5’-CCATAAAGCACCGGTGAGCAGAA-3’ endoglin specific reverse oligonucleotides (500 nM) using RevertAid H minus reverse Transcriptase (Thermo Scientific) 10 U/μl in 1X RevertAid H minus Buffer supplemented with 2 U/μl RNAse OUT (Thermo Scientific) ...