Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAB-developed samples were stored in 70% glycerol and counterstained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, #D3571, 1:1000) nuclear marker ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were then washed as above and incubated in 1 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) at RT for 10 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DAPI (4-6-diamidino-2-phenylindole) and DyLight 488-or DyLight 555-labeled secondary antibodies (1:400, Thermo Fisher Scientific, Waltham, MA) were added for 1.5h at room temperature ...
-
bioRxiv - Epidemiology 2019Quote: ... for 2 h at room temperature and incubated overnight at 4°C with rabbit polyclonal anti-myeloperoxidase (MPO, 1:100, Invitrogen, CA, USA) or rabbit monoclonal anti-F4/80 (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were subsequently rinsed in PBS and counterstained with 1:5000 dilution of DAPI (4′,6-Diamidino-2-phenylindole dihydrochloride, Invitrogen, Eugene, OR) in deionized water for 3-5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... hMOs were then washed overnight with 1X PBS at 4°C and incubated with Hoechst 33342 solution in 1X PBS for 2 h (1:1000, Thermo Fisher Scientific) and washed in PBS for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... Two hundred microliters of 2 μM calcein AM/4 μM ethidium homodimer-1 in PBS (Live/Dead® Viability Kit, Invitrogen, USA) were added to the wells and plates incubated for 30 min in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... D13+14 PT-enhanced organoids (triplicate wells per condition) were incubated in 4’,6-diamindino-2-phenylindole substrate (DAPI; 1:1000 [Thermo Fisher Scientific]) with 1:500 DRAQ7 dead cell label (Thermo Fisher Scientific] ...
-
bioRxiv - Neuroscience 2022Quote: ... They were stained for 2 days at 4°C with a mouse-derived antibody against GFP (1:400, mAB 3E6, Invitrogen, Darmstadt, Germany), washed for 2 hours at RT in 1x PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... The MTS were stained with a mixture of 2 μM calcein AM and 4 μM ethidium homodimer-1 in PBS (Thermo Fisher Scientific) to stain for live and dead cells ...
-
bioRxiv - Cell Biology 2022Quote: ... 45 s in air at 15 mA and 0.4 mbar) holey carbon grid (C-flat: 2/1-3C-T) and vitrified using a FEI Vitrobot Mark IV (Thermo Fisher Scientific) after blotting for 3 seconds with blot force 18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 14-17 h at 4°C followed by the incubation with 100 μl of Dynabeads Protein A + G (2:1 A:G proportion, Invitrogen, 10001D and 10004D) for 2 h at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... S2P6 was serially diluted 1:4 starting at 80 μg/ml in infection media (DMEM supplemented with 2% FBS and 20mM HEPES (Gibco, 15630-080)) and incubated with replication-competent VSV-SARS-CoV-2 (23 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed three times with PBS and incubated for 2 h at 4°C with appropriate combinations of AlexaFluor-conjugated secondary antibodies (Invitrogen,1:2000) for 2 hours at 4C protected from light ...
-
bioRxiv - Biochemistry 2021Quote: ... Usually 5 µg of total protein or the total protein of 1 to 2 × 106 autophagosomes were subjected to 4 – 12 % NuPage Bis-Tris gels (Thermo Scientific, MP0335) and transferred onto a nitrocellulose membrane using the Trans-Blot Turbo RTA mini nitrocellulose transfer kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... is purchased from MakingCosmetics Inc. (USA). 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1M solution, Cat. No. J16924-AP) is purchased from Thermo Scientific (USA). Silica beads (Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were labeled with DAPI together with the secondary antibody (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10.000, Thermo Fisher Scientific, #D1306). The following secondary antibodies were used ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated at 65°C for 5 min and then immediately chilled on ice for at least 2 min before adding 4 μL reverse transcription reaction mix [in 10 μL RT reaction: 1× First Strand buffer (Invitrogen – 18064- 014), 20 mM DTT (Invitrogen - 18064-014) ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour, followed by incubation with primary antibodies (overnight, 4°C) and secondary antibodies (1-2 hours, from Jackson ImmunoResearch or ThermoFisher Scientific). The slides were then mounted with coverslips using VECTASHIELD (Vector Labs ...
-
bioRxiv - Immunology 2023Quote: ... CTLA-4 or PD-1) were suspended in IL-2 medium at 37°C containing either 65nM LysoTracker® Deep Red (ThermoFisher Scientific) or 25nM MitoTracker™ Red CMXRos for 1h or 30min ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl polar metabolite extract were injected in push partial mode using an overfill factor of 1 onto a Dionex IonPac AS11-HC column (2 mm × 250 mm, 4 μm particle size, Thermo Fisher Scientific), additionally this was equipped with a Dionex IonPac AG11-HC guard column (2 mm × 50 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... cells at 70-80% confluency were switched to myogenic differentiation medium (DMEM, 4% horse serum, 2 mM Glutamax, 1 mM sodium pyruvate (Life Technologies #11360070), 1 μg/mL insulin (GeminiBio #800122 ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... Samples were separated on a NuPage 3-8% Tris-Acetate gel (Thermo Fisher Scientific), blotted onto nitrocellulose membrane and analyzed for EP300 and vinculin (loading control ...
-
bioRxiv - Molecular Biology 2019Quote: ... precipitated with acetone and separated on Tris-Acetate 3-8% polyacrylamide gel (NuPage, Invitrogen) before transfer to nitrocellulose membrane (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or with NuPAGE Novex 3 - 8% Tris-Acetate gels (ThermoFisher Scientific, EA0375BOX and WG1602BOX) using NuPAGE Tris-Acetate SDS buffer (ThermoFisher Scientific ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... Thawed samples were run on precast NuPAGE 3-8% Tris-Acetate gels (Invitrogen, WG1602BOX) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were loaded on a NUPAGE 3-8% Tris acetate gel (Thermo Fisher Scientific) or 4-15% mini PROTEAN Tris-Glycine gel (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... blot (Figure 1B) was run on a NuPAGE 3-8% Tris-acetate gel (Invitrogen). From selected clones genomic DNA was isolated using phenol extraction and genotyping PCRs were done as described above.
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were separated by SDS-PAGE with NuPAGE 3%–8% Tris-Acetate gels (Invitrogen) and the mono-ubiquitinated FANCI and FANCD2 were verified using mass spectrometry.
-
Modified N-linked glycosylation status predicts trafficking defective human Piezo1 channel mutationsbioRxiv - Biophysics 2020Quote: ... and loaded and run on a 3-8% Tris-Acetate gel (Thermo Fisher Scientific) before being transferred to a nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein extracts were directly resolved on Tris-acetate 3-8% polyacrylamide NuPAGE gels (Invitrogen). Proteins were transferred to a nitrocellulose Hybond-C membrane (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... NuPAGE™ 3-8% Tris-Acetate Protein Gels was purchased from Invitrogen (Cat# EA03785BOX). Novex™ HiMark™ Pre-stained Protein Standard was purchased from Invitrogen (Cat# LC5699).
-
bioRxiv - Molecular Biology 2022Quote: ... samples were run on a 3-8% Tris-acetate gel (Thermo Fisher Scientific, EA0375PK2) at 100V for 2 hours and wet transferred (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were resolved in 3-8 % NuPage Norvex tris-acetate Protein Gels (Life Technologies) and transferred to PVDF membranes (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... or pre-cast NuPAGE™ 3-8% Tris-Acetate gradient Gels (Thermo Scientific, EA0378BOX) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Systems Biology 2023Quote: ... We then separated protein complexes using 3-8% Tris-acetate gels (Thermo Fisher, EA0378) and native running buffer (90 mM Tris Base ...
-
bioRxiv - Biochemistry 2022Quote: ... After cell lysis and separation in a 3-8% Tris-acetate polyacrylamide gel (Invitrogen), proteins were transferred to a nitrocellulose membrane (Cytiva) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100μg of the lysate was loaded into 3%-8% precast gels (EA0378, Invitrogen™).
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Eluted proteins were separated on 3%–8% Tris-Acetate NuPAGE precast gels (Life Technologies) at 150 V for 70 min and were transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2023Quote: ... After cell lysis and separation in a 3-8% Tris-acetate polyacrylamide gel (Invitrogen), proteins were transferred to a nitrocellulose membrane (Cytiva) ...
-
bioRxiv - Genomics 2024Quote: ... Samples (1E5 cells) were loaded and run on 3-8% Tris-Acetate Gels (ThermoFisher) in Running Buffer (1x NuPage Tris-Acetate Running Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were loaded and run on NuPAGE 3-8% Tris-Acetate Gel (Invitrogen, EA0378BOX) at 120V for 15 minutes then 180V for 40 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...