Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... typically 2-20 μg samples were loaded on 4–12% Bis-tris gradient gels (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coverslips were mounted with ProLong Gold antifade plus 4’,6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Physiology 2023Quote: ... isolated FDB fibers were loaded with 4 µM fura-2 AM (Thermo Fisher, Carlsbad, CA, USA) in Ringer’s solution at room temperature (RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were counterstained with 0.3 µM 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies, OR, USA) for 15 minutes before rinsing with cold phosphate-buffered saline pH = 7.5 (Panum Institute Substrate Department ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatants were first precleared for 2 h at 4°C using Protein G Dynabeads (Invitrogen). Precleared samples were immunoprecipitated with anti-H3K9me3 (abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 4 mL trituration buffer (Hibernate-A with 2% B27; ThermoFisher Scientific) and 2 mM sodium pyruvate (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were resuspended in PBS containing 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, #D1306) and analyzed with CytoFLEX Flow Cytometer (Beckman Coulter).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Embryos older than 4 days were treated with 2 u/µl T1 RNAse (Thermo Fisher Scientific) after probe washing in order to reduce background ...
-
bioRxiv - Bioengineering 2023Quote: ... Hoechst 33342 trihydrochloride trihydrate and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... fetal bovine serum (FBS) and 4’,6-diamidino-2- phenylindole (DAPI) were purchased from Life Technologies. Antibiotics (penicillin/streptomycin ...
-
bioRxiv - Biophysics 2023Quote: ... covered with sulfosuccinimidyl 6(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (ThermoFisher Scientific, Loughborough, UK) 0.5 mg/mL in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... counterstaining was performed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Thermo Fisher Scientific, Cat# D1306) (1μg/ml ...
-
bioRxiv - Genetics 2024Quote: ... media was half-changed every 4 days with 2 µg/mL Natural Mouse Laminin (ThermoFisher Scientifics). Recordings were performed starting on day 115 using a Maestro Edge MEA system and AxIS Software Spontaneous Neural Configuration and Viability Module ...
-
bioRxiv - Immunology 2024Quote: ... Dead cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA) (1.0 μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µg of plasmid DNA was mixed with 4 µL of Lipofectamine 2000 (ThermoFisher Scientific #11668019) in 300 µL of Opti-MEM without any additives ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 4x10min washes in PBS-Tr at RT with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) added during the third wash ...
-
bioRxiv - Cancer Biology 2024Quote: ... Counterstaining was done with 4’,6-diamidino-2-phenylindole ([DAPI], Thermo Fisher Scientific, #121101, 1µg/ml) for 15 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were mounted using Prolong Gold supplemented with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Specimens were examined on a Zeiss Axiovert 200M microscope and images captured with an Axio-Cam MRm camera ...
-
bioRxiv - Microbiology 2020Quote: ... 4 and 8 were initially cloned into pCDNA3.1/myc-His A (Invitrogen) and were later subcloned into pBJ5 vector using the NEBuilder HiFi DNA assembly kit (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: ... samples resolved on 8% or 4-12 % Bis-Tris Plus gels (Invitrogen) and then transferred to nitrocellulose membrane for 7 min at 20 V using the iBlot 2 Dry Blotting System (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... 8 µL 2 mM dNTPs (Thermo Fisher Scientific cat# R0241), 6.4 µL 10 µM 5’ 6-FAM-labelled CAG1 primer 34 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15N2 L-lysine-2 HCl (Lys-8) (Thermo Fisher Scientific). Cells were kept in a humidified atmosphere with 5% CO2 at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... and Di-8-ANEPPS (Invitrogen™, cat. D3167, 2 µM) at 5% CO2 at 37 °C for 15-20 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15N2 L-lysine-2 HCl (Lys-8) (Thermo Fisher Scientific). To avoid contamination of light amino acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μL of input and 10 μL of eluate were separated on NuPAGE 3-8 % Tris-Acetate gels (Thermo Fisher Scientific) run at 4 °C and 35 mA/gel for 1.5 h ...
-
bioRxiv - Cell Biology 2023Quote: ... From day 0 to day 5 the medium was changed daily with 2 mL DMEM/F-12 containing 20% KnockOut™ Serum (ThermoFisher), 1 x Non Essential Amino Acid (NEAA ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with Alexa-Flour-488 or 555 secondary antibodies (1:1000) along with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Camarillo, CA, 1:1000) for 1 hr at room temperature (RT) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:200 O/N at 4 °C) and Alexa Fluor 594-conjugated anti-mouse IgG antibody (#A11005, Invitrogen, 1:2000 for 2 hours RT). Nuclei staining was done in 0.5 μg/mL Hoechst 33324 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Counter-staining cell nuclei with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 μg ml−1 in PBS) and F-actin with Alexa Fluor dye conjugated phalloidin (Invitrogen) was also done at this step ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was changed to neural induction media (1:1 mixture of DMEM/F-12 GlutaMAX: Neurobasal media supplemented with 0.5x N-2 (Life Technologies), 0.5x B-27 (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...