Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 200 μL of PBS containing 1.5 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) was added for 30 min and exchanged to PBS ...
-
bioRxiv - Genomics 2019Quote: ... Sections were stained with DAPI (4’,6’- diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Images were obtained by confocal microscopy (Nikon C2+ Eclipse ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4-6-diamidino-2-phenylindole (NucBlue™ Fixed Cell ReadyProbes™ Reagent, R37606, Thermo Fisher) for 5 minutes at room temperature and mounted onto glass slides using ProLong™ Gold antifade reagent (Molecular Probes ...
-
bioRxiv - Microbiology 2019Quote: ... cell nuclei were stained with 30 nM DAPI (4′,6-diamidino-2-phenylindole, Invitrogen, Eugene, OR, USA) for 5 min and the coverslips were mounted onto glass slides with CitiFluor AF1 antifading (Electron Microscopy Sciences ...
-
bioRxiv - Plant Biology 2021Quote: ... stratified for 2 days at 4°C and grown for 11 days in a Sanyo (Fisher Scientific) under short-day conditions (8 h light ...
-
bioRxiv - Microbiology 2021Quote: ... Transgenic parasites were selected with 4 nM WR99210 (Jacobus Pharmaceuticals) or 2 μg/ml blasticidin S (Invitrogen). To select for integrants by SLI ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Alexa Fluor™ 488 (#C10337) and 4’,6-diamidino-2-phenylindole (DAPI; #62248) were purchased from Invitrogen-ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were incubated with Dapi (4′,6-Diamidine-2′-phenylindole dihydrochloride) in mounting medium (Molecular Probes). Afterward ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were incubated with Dapi (4′,6-Diamidine-2′-phenylindole dihydrochloride) in mounting medium (Molecular Probes). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081), penicillin (100 U/μL) ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat ...
-
bioRxiv - Immunology 2021Quote: ... The nucleus was stained with 50 ng/ml 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen Cat. #D1306) for 10 min at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) staining was used to visualize the nuclei (Thermo Fisher Scientific). Fluorescence was assessed using a fluorescence laser microscope (LSM780 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The broad-spectrum serine proteinase inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) was obtained from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were then incubated with rotation for 2 hours (at 4°C) with Talon cobalt resin (Thermofisher). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... sections were counterstained with 0.2 µg/ml 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Cat# 62248) diluted in 1xPBS for 15-30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: Lysates were then incubated with rotation for 2 hours (at 4°C) with Talon cobalt resin (Thermofisher). After incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... pH-7.4) and then loaded with the ratiometric Ca2+ indicator Fura-2 AM (4 µM) (Acetoxymethylester, Invitrogen) along with 0.002% Pluronic F-127 for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2021 Total RNA was extracted from 2-4 day old female ovaries using the MirVana kit (Ambion). rRNA was depleted using antisense rRNA oligo hybridization with subsequent RNase H digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 dpf zebrafish larvae were dechorionated and fixed with 4% formaldehyde methanol-free (Pierce™ Thermofisher, #28906) in BT buffer (1.0g sucrose ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... After another set of gentle washes and 4′,6-diamidino-2-phenylindole (DAPI) nuclear staining (Thermo Scientific, R37606 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were visualized with 4′,6-diamidino-2-phenylindole (DAPI) in SlowFade Diamond antifade mounting medium (ThermoFisher). Primary antibodies were incubated with tissues overnight at 4°C in 1% normal donkey serum ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei staining was performed with 4’,6 diamidino-2-phenylindole dihydrochloride (DAPI, Molecular Probes, Eugene, OR, USA) at 300 nM in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 0.02 mg/mL, ThermoFisher Scientific, USA), mounted and cover-slipped before being imaged with the Zeiss Axio Imager.Z1 Microscope ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) NucBlue (Cat. #: R37606; Thermo Fisher Scientific). Slides were mounted using Aqua-Poly/Mount (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 2 hour incubation at 4℃ with 50 µL of magnetic Dynabeads Protein G (Invitrogen, #10004D). Beads were washed with 1x TBS Tween-20 washing buffer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sections were mounted with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, Waltham, MA, United States) before imaging and we examined more than five different microscopic images (per section ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The caspase-3 activity was quantified using EnzChek™ Caspase-3 Assay Kit #1 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Cell Biology 2019Quote: ... The following dilutions were used for secondary antibodies and cell dyes for staining: goat anti-rabbit Alexa Fluor 488 F(ab’)2 Fragment (2 μg/ml, A11070; Molecular Probes), goat anti-mouse Alexa Fluor 488 F(ab’)2 Fragment (2 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 24 h later the dish was washed with PBS and treated with PR8 virus (MOI =2) in the infection medium [F-12K with 2% BSA fraction V (Thermo Fisher), 1% antibiotic-antimycotic (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... precast 4-12% or 8% Bis-Tris gels were used (Thermo Fisher Scientific) with NuPAGE MOPS SDS running buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were separated on 8% SDS-PAGE or 4-12% NuPAGE gels (ThermoFisher) and proteins transferred to a methanol activated PVDF membrane (Immobilon ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Microbiology 2019Quote: ... Neural maintenance medium base (50% DMEM-F-12 medium-GlutaMAX, 50% Neurobasal-A medium, 1 × N-2 supplement, 1 × B-27 supplement [Life Technologies]) supplemented with 1% DMSO (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Bioengineering 2021Quote: ... + 1 × 10−3 M sodium pyruvate (Gibco) + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.