Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Biophysics 2024Quote: ... and 250 µM of EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Thermo Scientific, 24510) in Borate buffer (100 mM Borate-NaOH ...
-
bioRxiv - Neuroscience 2021Quote: ... precast 4-12% or 8% Bis-Tris gels were used (Thermo Fisher Scientific) with NuPAGE MOPS SDS running buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were separated on 8% SDS-PAGE or 4-12% NuPAGE gels (ThermoFisher) and proteins transferred to a methanol activated PVDF membrane (Immobilon ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM KPi and 4-8 mg/mL 3,000MW tetramethylrhodamine dextran (Invitrogen, D3308) solution ...
-
bioRxiv - Bioengineering 2024Quote: ... Spherical beads (4, 6, 8 and 10 μm diameter) were sourced from Invitrogen.
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2019Quote: ... Neural maintenance medium base (50% DMEM-F-12 medium-GlutaMAX, 50% Neurobasal-A medium, 1 × N-2 supplement, 1 × B-27 supplement [Life Technologies]) supplemented with 1% DMSO (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Bioengineering 2021Quote: ... + 1 × 10−3 M sodium pyruvate (Gibco) + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... or TO-PRO-3 (1:50000, ThermoFisher) for 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... claudin-3 (1:200; Thermo Fisher Scientific), claudin-15 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteinase K (3 μg ml−1; ThermoFisher) digestion ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... and TO-PRO-3 (1:5000, ThermoFisher). The combination of Nucred Dead 647 and TO-PRO-3 has previously been described by Dekkers et al24 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine RNAiMAX (Thermo Scientific, 13778030, 1:3), FuGene HD (Promega ...
-
bioRxiv - Immunology 2020Quote: ... and 2 mM glutamine 8 (all ThermoFisher Scientific, Waltham, MA, USA). In the post-infection medium ...
-
bioRxiv - Microbiology 2022Quote: ... PV-3 SC8 VLPs or infectious PV-1 were incubated with 5 µM SYTO9 (Thermo Fisher) and SYPRO red (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... hPSC differentiation into endoderm was performed in serum-free differentiation (SFD) medium of IMDM/Ham’s F-12 (3:1) (Life Technologies, Carlsbad, CA) supplemented with the following ...
-
bioRxiv - Genetics 2019Quote: ... and 2 unaffected individuals (II.1 and II.3) were analyzed with the Affymetrix GeneChip® Mapping 250K Array Xba 240 (Affymetrix, Santa Clara, CA). Sample processing and labelling were performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... determined by preparing a slurry with 1 part soil to 2 parts deionized water and measuring (n=3) with an Orion Star A111 pH Meter (Thermo Scientific, Waltham, MA, USA), was 5.87 ± 0.42 in November 2020 and 6.28 ± 0.07 in April 2021.
-
bioRxiv - Cell Biology 2023Quote: ... organoids were washed 3 times in DPBS and incubated for 2 hours with Alexa Fluor 647-conjugated anti-mouse secondary antibody (Thermo Fisher Scientific, 1:1000) in blocking buffer at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 ng/ml of fibroblast growth factor-2 (FGF-2) (all from Gibco). Cells were seeded at a density of 3200 cells/cm2 until they reached 90% confluency ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluo-4 (Fluo 4 AM/Fluo 4 direct, Life Technologies) was used according to the manufacturer’s instructions and a previously published protocol (54) ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Cell Biology 2023Quote: ... Frozen rat ovarian follicles were homogenized in 400 µL lysis buffer (100 mM HEPES, pH 8, 4% SDS, 1 mM EDTA, and 1× Halt protease/phosphatase inhibitor cocktail (ThermoFisher Scientific) using Zirconia/glass beads in a bead beating grinder (FastPrep24 ...
-
bioRxiv - Bioengineering 2024Quote: ... and Octamer-binding transcription factor 4 (OCT-4; 1:40, Invitrogen, MA5-14845), were incubated for 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were analyzed with the MACSQuant cell analyzer (3 lasers, 10 parameters, Miltenyi Biotech) or the AttuneNxT acoustic focusing cytometer (4 lasers, 14 parameters, Thermo-Fisher Scientific). Data were processed using FlowJo software (ver.9.9 or 10.7 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were then washed 3 times for 4 min with TBST and treated with Pierce ECL Western Blotting Substrate (Thermo Scientific) according to manufacturer protocol ...
-
bioRxiv - Genomics 2020Quote: ... where 2–3 mm of the terminal ends of 3–4 filaments from the left side each fish were collected and placed in RNAlater (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... an Agilent LC-MS system consisting of a 1100 HPLC and a 1946D single quadrupole ESI mass spectrometer equipped with a MabPac RP column (3 × 50 mm, 4 µm, Thermo Scientific) or 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h at RT and then incubated for 3 days at 4°C with the monoclonal mouse anti-NeuN antibody conjugated with Alexa-488 (clone A60, Life Technologies) at a concentration of 0.5 µg mL-1 into blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... and then rinsed 3 times in sterile water and 4 times in Dulbecco’s Phosphate-Buffered Salines (DPBS) (ThermoFisher Scientific, Waltham, MA) [4] ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µg of an HA-tag antibody (MBL, M132-3) was mixed with 20 µL of Dynabeads Protein G (Invitrogen, #10004D) and subsequently added to extracts ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were subjected through high pH reverse phase fractionation into 3 or 4 fractions and all fractions were run independently on an Orbitrap Fusion (Thermo Scientific) mass spectrometer coupled to an Acquity M-Class nanoLC (Waters Corporation) ...
-
bioRxiv - Immunology 2022Quote: ... Proteins and DNAs were incubated for 30 min at 4 °C and analyzed on 3-12% gradient Bis-Tris native gels (Life Technologies) at 4 °C ...