Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... RT-qPCR reactions were conducted on the Viia 7 Real-time PCR System (Applied Biosystems, USA) with SYBR Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesized using the Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen). Probes for EPB41 and actin beta transcripts (EPB41_1_For AACTTCCCAGTTACCGAGCA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using the SuperScript® III Frist-Strand Synthesis System for RT-PCR (Invitrogen). Reactions were run with SsoAdvancedTM Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR: Reverse transcription were performed using SuperScript IV RT (Thermo Fisher Scientific, Waltham, MA, USA) and qRT-PCR using appropriate primers (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real-time RT-PCRs were performed in a QuantStudio 7 Flex System (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were performed on QuantStudio 12 K Flex Real-Time PCR System (Applied Biosystems) and analyzed with the QuantStudio 12 K Flex Applied Biosystems software v1.2.3 ...
-
bioRxiv - Genomics 2024Quote: ... cDNA synthesis was performed using the SuperScript III First-Strand RT-PCR Kit (Thermo Fisher Scientific) with an oligo-dT primer based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and the reverse transcription was performed using Superscript FirstStrand Synthesis for RT-PCR (Invitrogen, CA, USA). cDNA was amplified using the Master Mix kit (Thermofisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) per manufacturer methods and as previously published49 ...
-
bioRxiv - Immunology 2021Quote: ... The purified PCR products were then sequenced with gene-specific primers or cloned with the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Waltham, USA) and introduced into competent DH5α E ...
-
bioRxiv - Cancer Biology 2022Quote: ... and gene specific primers were used for PCR amplification and detection on a 7500 FAST Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific). Relative mRNA levels were determined by comparing the PCR cycle thresholds between cDNA of a specific gene and beta actin for mouse or histones for human (ΔCt).
-
bioRxiv - Developmental Biology 2021Quote: ... Specific primer pairs were used in each qRT-PCR reaction with the SYBR Green PCR Master Mix kit (Applied Biosystems, Foster City, CA, USA) on the 7300 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR amplicons were sequenced directly using the amplifying primers or cloned with Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher, San Jose, CA, USA) and transformed into Stellar Competent Cells (Takara) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and various sets of gene-specific forward and reverse primers and subsequently subjected to real-time PCR quantification using a StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The following primer sequences were used ...
-
bioRxiv - Biochemistry 2020Quote: RT assays were performed with AMV RT (ThermoFisher), HIV-1 RT (AS ONE Corp.) ...
-
bioRxiv - Physiology 2019Quote: ... The PCR cycle parameters were set according to the recommended guidelines for the TaqMan Fast Advanced Master Mix (Applied Biosystems), which was used to run the qPCR reactions (95 °C for 2 min [polymerase activation] followed by 40 cycles of 95 °C for 1 s [denture] and 60 °C for 20 s [anneal/extend]) ...
-
bioRxiv - Genetics 2019Quote: A set of 4x 40 µl of PCR reaction was mixed with 8 µl 6x DNA load dye (Thermo Scientific) and run on a 2% TBE agarose gel (UltraPure ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were performed using the pre-set program of the ABI ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... and set up with the 7500 Real Time PCR System software version 2.0 (Applied Biosystems, Life Technologies™, California, USA). The reactions underwent PCR amplification as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... quantitative-PCR was carried out using TaqMan™ Array Rodent MicroRNA A+B Cards Set v3.0 (Applied Biosystems™, 4444909). The data were analyzed using ViiA 7 Software and R program ...
-
bioRxiv - Molecular Biology 2022Quote: ... and set up with the 7500 Real Time PCR System software version 2.0 (Applied Biosystems, Life Technologies™, California, USA). The reactions underwent PCR amplification as follows ...
-
bioRxiv - Genomics 2022Quote: Quantitative PCR (qPCR) reactions were set up utilizing the 2 x PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, A25777) containing final 250 nM forward /reverse primer (s ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primers were designed using Primer Express (Applied Biosystems) software.
-
bioRxiv - Evolutionary Biology 2019Quote: ... Primers were designed using Primer Express software (Applied Biosystems) and optimized for annealing temperature of 60°C ...
-
bioRxiv - Cell Biology 2020Quote: ... each specific primer at 200 nM (Table 1) and SYBR Green PCR Master Mix (Thermo Fisher Scientific), following the manufacturer conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.
-
bioRxiv - Bioengineering 2021Quote: ... TaqMan™ reagents and primers for real-time polymerase chain reaction (PCR) were purchased from Applied Biosystems by Thermo Fisher (Waltham ...
-
bioRxiv - Cell Biology 2021Quote: ... and specific primers on a 7,500 Fast Transient transfection Real Time PCR System (Applied Biosystems, Life Technologies). Amplification was performed at 95°C for 12 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and specific primers on a 7,500 Fast Transient transfection Real Time PCR System (Applied Biosystems, Life Technologies). Amplification was performed at 95°C for 12 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were genotyped using a quantitative PCR reaction utilizing the following primers and probes (Thermo Fisher Scientific):
-
bioRxiv - Microbiology 2020Quote: ... in technical triplicates using Taq-Man PCR technology with the following Taqman probes and primers (Thermo Fisher): human IFITM3 (assay ID Hs03057129_s1) ...
-
bioRxiv - Immunology 2022Quote: ... and the primers listed in table S1 on a ViiA 7 Real-Time PCR System (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Microbiology 2020Quote: ... Che cheY3 gene was first amplified by PCR (primers P15/P16) using DNA polymerase (Invitrogen, Carlsbad, CA) with engineered BamHI and SacI cut sites at its 5′ and 3′ ends ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200nM of the appropriate primers on the Quant Studio 3 Real Time PCR system (Applied Biosystems). Relative expression level for each gene was quantified based on a standard curve of serially diluted control cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... Gene expression was measured by qRT-PCR using gene-specific primers (Table S1) and PowerSYBR Green (Invitrogen). Samples were run in triplicate and normalized to an S7 reference gene and quantified using the 2−ΔΔCT method as previously 33.
-
bioRxiv - Bioengineering 2022Quote: ... Quantitative PCR was performed using PrimeTime qPCR Primers (Integrated DNA Technologies) and PowerUp SYBR Green (Thermo Fisher) on a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... the forward and reverse primers listed in Supplementary Table 2 and a StepOnePlus qRT-PCR thermocycler (Thermofisher). Expression of genes of interest was quantified using the delta CT method using Ribosomal protein L19 (RPL19 ...
-
bioRxiv - Microbiology 2022Quote: ... with specific primers (Table S4) and detected by Step One Plus Real time PCR machine (Applied Biosystems). Relative quantification of gene expression was performed using the comparative Ct Method (52 ...
-
bioRxiv - Physiology 2022Quote: ... and primer pairs were run in triplicates on a QuantStudio 5 Real-time PCR instrument (Applied Biosystems). Primers were designed using the NCBI/Primer Blast tool (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed on complementary DNA using primers with PowerTrack SYBR Green Master Mix (Thermo Fisher). Reactions were run on a QuantStudio 6 pro (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... variant S fragments were amplified by bridge PCR with mutation-containing primers and cloned into pcDNA4TO (Invitrogen). To express HA-tagged spike protein ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the appropriate cDNA and primers were run in a 7500 Real-Time PCR System (Applied Biosystems). Samples were normalized to the levels of sply and fold changes were calculated using the ddCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... primer/probe mixes were used together with Taqman 2× Universal PCR Master Mix (Thermofisher Scientific, cat# 4318157), as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... primers and miRNAs were detected using miRNA-specific Taqman probes and Taqman Universal PCR mastermix (Thermo Fisher). All miRNAs were normalized to hsa-miR-16 ...
-
bioRxiv - Biophysics 2024Quote: Mutations were generated with partially overlapping primers and PCR with Phusion Hot Start II DNA Polymerase (ThermoFisher) according to published guidelines 70 ...
-
bioRxiv - Cancer Biology 2019Quote: ... First-strand cDNA synthesis was performed on 5 µg of total RNA from either fresh tumor tissue or archival FFPE CIN3 tissue using the exon 4 primer and SuperScript™II RT (Thermo Fisher Scientific) following manufacture’s protocol ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... Point eight μg of DNase-treated RNA was reverse-transcribed with a reverse transcription (RT)-specific primer using High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems, Waltham, MA) or SuperScript IV Reverse Transcriptase (18090200 ...