Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 5010 citations for Scyliorhinin II amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Mtb genomes were then quantified using Taqman Universal Master Mix II (Life Technologies) and previously published sigF primer-probe combination (Lin et al. ...
-
bioRxiv - Immunology 2022Quote: ... Cell number was determined using a Countess II FL automated cell counter (Invitrogen). Adhesion profile was assessed by two independent observers to determine the total number of adhesions within the peritoneal cavity after surgery and also an arbitrary adhesion score ...
-
bioRxiv - Genetics 2022Quote: ... Cells were counted with Trypan blue using a Countess II automated counter (ThermoFisher) and then passaged every 2-3 days ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram of total RNA was used for reverse transcription (Superscript II, Invitrogen). Transcript levels were quantified by quantitative PCR in a Stratagene MX3005P instrument (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... reagents used for the reverse transcription (RT) reaction such as Superscript II (Invitrogen) and RNasein Plus (Promega) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 nM (1x) of SYBR™ Green II RNA Gel Stain (Invitrogen) in the reaction buffer -containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 nM (1x) of SYBR™ Green II RNA Gel Stain (Invitrogen) in the reaction buffer containing 40 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cell count we used Countess II automated cell counter (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2022Quote: ... following this cells were counted using an automated cell counter (Countess II, Invitrogen). If cells were to be treated with para-Amino-Blebbistatin (Cayman Chemical ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using random primers and Superscript II reverse transcriptase (Life Technologies). Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Reverse transcription was carried out using the SuperScript™ II Reverse Transcriptase (Invitrogen) and qPCRs using the qPCRBIO SyGreen Mix Separate-ROX (NIPPON).
-
bioRxiv - Microbiology 2022Quote: ... biofilms were grown in Nunc™ LabTekTm II Chamber Slide™ System (Thermofisher) with 1 mL of diluted culture ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse-transcribed using SuperScript® II RT (Invitrogen, Carlsbad, CA, USA), oligo dT and random primers ...
-
bioRxiv - Plant Biology 2022Quote: ... The reaction was catalyzed by LR Clonase™ II Mix (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Physiology 2022Quote: ... C-IV-II and C-V-alpha (ThermoFisher Scientific, 45-8199; 1:2500). Secondary antibodies used were horseradish peroxidase–conjugated anti-mouse (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2022Quote: ... via an Ion Max ion source with a HESI II probe (Thermo Scientific). A Sequant ZIC-pHILIC column (2.1 mm i.d ...
-
bioRxiv - Plant Biology 2022Quote: ... and cloned into the pDONR207 using a BP Clonase II Kit (Thermo Fisher). Chemically competent Escherichia coli DH5α cells were transformed by the heat-shock method (Dagert and Ehrlich 1979) ...
-
bioRxiv - Plant Biology 2022Quote: ... Using the Gateway® LR Clonase™ II kit (Invitrogen Corp., Carlsbad, CA), DDP1 was recombined with Gateway plant destination vectors pK7FWG2 (C- terminus DDP1-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... (ii) Incubation with a buffer containing hydroxylamine (NH2OH, Fisher Scientific, Cat no. 26103) that cleaves cysteine-linked palmitate thioester bonds or with control buffer that instead of hydroxylamine contains Tris ...
-
bioRxiv - Molecular Biology 2022Quote: Skin and wounds were incubated in dispase II (5 U/mL, ThermoFisher Scientific) at 4°C overnight ...
-
bioRxiv - Immunology 2022Quote: ... The cells were counted using the Countess II Automated Cell Counter (Thermo Fisher) to determine the suspension volume to transfer to obtain 5,000 cells ...
-
bioRxiv - Immunology 2022Quote: ... a template-switch adaptor (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) and the Superscript II RT enzyme (Invitrogen). The cDNA was then purified using AMPure XP Beads (Agencourt) ...
-
bioRxiv - Systems Biology 2024Quote: ... Genomic regions were PCR-amplified (Platinum SuperFi II PCR master mix, ThermoFisher 12368050) using a pair of primers at least 200 bp away from the 5’ and 3’ ends of the sgRNA targeted site ...
-
bioRxiv - Microbiology 2024Quote: ... and 2mM copper (II) sulfate pentahydrate all dissolved in UltraPure distilled water (Invitrogen) (90) ...
-
bioRxiv - Biochemistry 2024Quote: ... using XCell SureLock Mini-Cell system with the XCell II Blot Module (Invitrogen). The membrane was cross-linked 5 min with UV ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized from 100 ng of total RNA using SuperScript II (Invitrogen). After RT-PCR with primers surrounding editing sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were stopped by adding 5 µL of Gel Loading Buffer II (Invitrogen). Primers for sequencing ladders were radiolabeled by incubating 200 nM sequencing primer (5’-CATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTG-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... FITC anti-mouse MHC II (Invitrogen, Cat# 11-5321-82, Clone M5/114.15.2), and PE anti-mouse CD207 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The pDONR221 library was cloned en masse using Gateway LR Clonase II (Invitrogen) into randomly barcoded iBFG-Y2H vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... 5ng of total RNA was reverse transcribed with SuperScript II (Thermo Fisher, 18064014) supplemented with betaine and MgCl2 using an oligo-dT RT primer (AAGCAGTGGTATCAACGCAGAGTACT(30)VN ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 mg/ml DNase (AppliChem GmbH) and 10 mg/ml Dispase II (Gibco) in 10 ml of the DMEM medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... one well was trypsinized and counted on the Countess II FL (Life Technologies). Two-way ANOVA was completed to determine statistical significance followed by Tukey’s test where applicable ...
-
bioRxiv - Neuroscience 2023Quote: ... All cDNA fragments were cloned into pCR-Blunt II TOPO vector (Invitrogen 450245) and DIG-UTP labelled cRNA probes synthetized from linearized plasmids using either SP6 or T7 RNA polymerases (Roche ...
-
bioRxiv - Immunology 2023Quote: ... The isolated cells were counted using the Countess Automated Cell Counter II (ThermoFisher) and re-suspended at 0.5 x 106 cells/mL in RPMI 1640 (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... and products separated on 2% EX e-gels containing SYBR Gold II (Invitrogen). qRT-PCR using custom TaqMan primers/probes was performed with TaqMan Fast Advanced Master Mix on a QuantStudio 3 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2024Quote: ... were used in conjunction with Taqman Universal Master Mix II (Applied Biosystems; #4440038) for quantitative reverse transcription PCR analysis on the StepOne/QuantStudio 6 Flex Real Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... via an Ion Max ion source with a HESI II probe (Thermo Scientific). The mobile phase consisted of buffer A ...
-
bioRxiv - Molecular Biology 2023Quote: ... via an Ion Max ion source with a HESI II probe (Thermo Scientific). The mobile phase consisted of buffer A ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were then counted using Countess II automated cell counter (Life Technologies). Cell numbers were plotted by GraphPad Prism 9.
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was prepared using RnaseOUT and Superscript II according to manufacturer’s manual (Invitrogen). qTower 3 from Analytik Jena was used to perform qPCR ...
-
bioRxiv - Immunology 2024Quote: ... Cells were counted in 0.4% Trypan Blue using Countess II (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... The RNA fragments were transcribed into cDNA using SuperScript II Reverse Transcriptase (Invitrogen), followed by second strand cDNA synthesis using DNA Polymerase I and RNase H ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences were confirmed before using Gateway LR recombination (LR Clonase II, Thermo Fisher) with pHVW (DGRC stock # 1089 ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was produced from the extracted RNA using Superscript II enzyme from Invitrogen. RT-qPCR was performed on obtained cDNA using the iQ™ SYBR® Green supermix (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... Gels were stained for 20 min with SYBR™ Green II (Invitrogen™) and imaged using a Bio-Rad ChemiDoc imaging system.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were plated into a LabTek II chambered coverglass (#155409, Thermo Fisher Scientific) for at least 2 hours before filming ...
-
bioRxiv - Bioengineering 2024Quote: ... Tissues were digested in 3 mg/mL type II collagenase (17101-015, Gibco) reconstituted in culture media for one hour at 37°C followed by digestion in 0.5 mg/mL type II collagenase overnight at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... An enzymatic medium was prepared by adding 2 mg/mL dispase II (Gibco), 0.6 mg/ml collagenase P (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed using Phusion Hot Start II DNA Polymerase (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
An updated C. elegans nuclear body muscle transcriptome for studies in muscle formation and functionbioRxiv - Genetics 2023Quote: ... we performed a Gateway LR Clonase II plus reaction (cat. 12538-013; Invitrogen) using the destination vector pCFJ150 (Frøkjær-Jensen et al ...