Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Inhibin beta C chain INHBC Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative polymerase chain reaction (qPCR) was performed in triplicate using the 7300 Real-time RT-PCR system (Applied Biosystems) according to the manufacturer’s description using the following thermocycler parameters ...
-
bioRxiv - Immunology 2020Quote: ... 7.5μg of a plasmid encoding the light chain and 22.5μg of plasmid encoding heavy chain were co-transfected into Expi293F cells at a density of 2.0E6 cells/ml in Expi293 Expression Medium (ThermoFisher) using ExpiFectamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative polymerase chain reaction (qPCR) assessed RNA amount using a StepOnePlus™ Real-Time PCR System (Thermo-Fisher Scientific) relative to the internal control of 18S ribosomal RNA (18S rRNA) ...
-
bioRxiv - Genetics 2019Quote: ... mtDNA-CN was measured using multiplexed real time quantitative polymerase chain reaction (qPCR) utilizing ABI TaqMan chemistry (Applied Biosystems).[12] We calculated residuals using a linear mixed effect model stratified by race ...
-
bioRxiv - Microbiology 2019Quote: Stationary-phase reductase and electron transport chain activities were measured with Redox Sensor Green (RSG) dye (ThermoFisher, catalog# B34954) according to manufacturer’s instructors ...
-
bioRxiv - Immunology 2021Quote: Expi293 cells were transfected with plasmids encoding for the heavy and light chain at 1µg/mL (i.e. 0.5µg/mL each) according to the manufacturer’s instructions (ThermoFisher, manual for Cat#A14525). Dense Expi293 cultures (day 5-7 post transfection ...
-
bioRxiv - Cancer Biology 2021Quote: Samples for quantitative polymerase chain reaction (qPCR) were prepared with 1x Fast SYBR Green PCR master mix (Applied Biosystems). Primers were optimized for amplification under the following conditions ...
-
bioRxiv - Immunology 2021Quote: ... 100mL cultures of Expi293F cells at a density of 2.5×106 cells/mL were transiently transfected with 50µg each heavy and light chain encoding plasmids and Expifectamine (Invitrogen) per manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... Each polymerase chain reaction amplification was performed in triplicate wells in a StepOne Real-Time PCR System (Applied Biosystems) by using the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... 100mL cultures of Expi293F cells at a density of 2.5×106 cells/mL were transiently transfected with 50μg each heavy and light chain encoding plasmids and Expifectamine (Invitrogen) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... The plasmids encoding the heavy and light chain genes were later transiently transfected in Expi293F cells (Thermo Fisher Scientific), and the recombinant mAbs were purified by Protein A/G affinity chromatography as reported45.
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time polymerase chain reaction analysis (qRT-PCR) was performed using SYBR GreenER qPCR SuperMix for iCycler (Invitrogen) following suppliers recommended program ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted DNA samples were subjected to quantitative polymerase chain reaction (qPCR) analysis using the SYBR Green Master Mix (Invitrogen) supplied with the primers for ICP27 and β-actin on a Quant Studio 6 Flex qPCR system (Applied Biosystems).
-
bioRxiv - Systems Biology 2023Quote: ... We quantified cDNA abundance using quantitative-polymerase chain reaction (qPCR) using the QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time quantitative polymerase chain reaction (qPCR) was performed using PowerTrack SYBR Green master mix (Applied Biosystems, Waltham, MA) or ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech ...
-
bioRxiv - Immunology 2023Quote: ... Expi293F cells were co-transfected with heavy and light chain plasmid using Expifectamine (Thermo Fisher Scientific, Cat No. A14526) per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... IL-10: Rn00563409_m1) for real time reverse transcriptase polymerase chain reaction were from Applied Biosystems (Foster City, CA, USA).
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Quantitative-real-time polymerase chain reaction (qRT-PCR) was performed using TaqMan Fast Advanced MasterMix (Applied Biosystems MA, USA) and Taqman gene expression assays for OVCH1-AS1 (Hs04333030_m1 ...
-
bioRxiv - Microbiology 2024Quote: ... Real-time Polymerase Chain Reaction (qPCR) was conducted in a StepOnePlus™ Real-time PCR system (Applied Biosystems®) to analyze the relative expression of the genes of inducible nitric oxide synthase (iNOS ...
-
bioRxiv - Cell Biology 2019Quote: ... The samples were then rinsed with PBS (5 × 3 min) and incubated for 1 h at 37°C with the following secondary antibodies: anti-human Alexa 488 (Thermo Fisher, Waltham, MA, USA; 1:750) or anti-mouse Alexa 488 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... falciparum or human A549 total RNA was enriched by two successive rounds of purification with the Dynabeads mRNA purification kit (Thermo Fisher # 61006, Supplementary Fig. 1b,c).
-
bioRxiv - Immunology 2023Quote: ... recombinant human IL-3 (R&D, Cat. 203-IL-050/CF, 25 ng mL-1) or c) human M-CSF recombinant protein (Invitrogen, Cat. PHC9501, 100 ng mL-1). A partial medium change was performed every 48 hours with 2x cytokine composites to replenish cytokines ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primary anti-human CD38 antibody was applied at a dilution of 1:250 and incubated overnight at 4°C (Thermo Scientific clone RM388 Cat# MA5-36061). After washing with PBS ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biophysics 2019Quote: HEK293 cells were grown in 1:1 Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 Ham with Glutamax+ (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (Alkali Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... 293 cells from a pMLINK tetracistronic vector (courtesy of Y. Shi, Tsinghua University, Beijing).45 HEK293 cells were cultured in Freestyle 293 media (Life Technologies), shaking at 125 rpm while incubating at 37 oC with 8% CO2 until a density 2 × 106 cells/ml was reached ...
-
bioRxiv - Immunology 2021Quote: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific). Two days later ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 S gene containing plasmid p20017 and adenovirus backbone plasmid pAADV-C01 (Genemedi, China) were co-transfected into HEK293 based adapted viral production cell (ThermoFisher, USA). Viral production cells were seeded in a 6 well TC treated plate (Nest ...
-
bioRxiv - Cancer Biology 2022Quote: ... LCV2-GFP or LCV2-RFP were mixed with sPAX2 and MD2.G plasmids and transfected in HEK293 cells using Lipofectamine 2000 (Life Technologies). After 24h ...
-
bioRxiv - Neuroscience 2022Quote: SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (SP-RBD, Arg319-Phe 541; cat# RP-87678, HEK293 cell expressed and binds ACE2) was obtained from Life Technologies Corporation ...
-
bioRxiv - Immunology 2022Quote: ... All soluble SOSIP Envs were expressed by transient transfection in HEK293-6E cells (National Research Council of Canada) or Expi293 cells (Life Technologies) and purified from transfected cell supernatants by 2G12 affinity chromatography ...
-
bioRxiv - Genetics 2023Quote: HEK293 cells were harvested and lysed in RIPA lysis with 1X Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). The concentration of total protein was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Constructs carrying the 3’UTRs were transiently co-transfected with vectors carrying Renilla-Luciferase and either miR-122 mimic (122-MIM) or scramble oligos (SCR) into HEK293 cells with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...