Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were loaded onto a NuPAGE® Novex® 3–8% Tris-Acetate Gel3–8% (Thermo Fisher Scientific) and run in Novex Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Hemolymph sporozoites collected on days 19 to 24 post-infection were centrifuged for 5 min at 450 x g and 4 °C in an 8-well Lab-Tek chamber slide (Nunc) or a 384-well plate (Greiner) ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells with Fzd1/2/4/5/7/8 knocked out were provided by Michael Boutros (Voloshanenko et al., 2017) and maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gemini) ...
-
bioRxiv - Neuroscience 2022Quote: 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen) (10 μM ...
-
bioRxiv - Bioengineering 2019Quote: ... 5-Ethynyl-2′-deoxyuridine (EdU, Invitrogen) was prepared according to the manufacturer’s specifications and diluted in cell culture media to 10 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-Ethynyl-2’-deoxyuridine (EdU, ThermoFisher) was injected into the vitreous chamber to label proliferating cells ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) was dissolved in sterile PBS (5 mg/mL) ...
-
bioRxiv - Neuroscience 2023Quote: 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen) was injected i.p ...
-
bioRxiv - Neuroscience 2023Quote: 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) was dissolved at 0.2 mg/ml in the drinking water to detect proliferating cells ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Genetics 2021Quote: ... SDS-Page separation was completed by running between 3 and 10μg of total protein on a NuPAGE 3%–8% Tris-acetate gel (Thermo Fisher Scientific Scientific). Next ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml IL-4 (Life Technologies), and evaluated on day 6 of culture ...
-
bioRxiv - Microbiology 2022Quote: ... 4 µL linear acrylamide (5 mg/mL, ThermoFisher), and 1 mL of ice-cold 96% ethanol followed by overnight incubation at −20°C.
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5× phusion HF buffer (Thermo Scientific), 4 μL 5 M Betaine (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... isolated primary cells were co-cultivated with gamma-irradiated mitotically inactivated NIH3T3 mouse embryonic fibroblasts (MEFs) in a 3:1 mixture of Ham’s F-12 nutrient mix (Life technologies) and DMEM supplemented with 5 % FCS ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were maintained in Ham’s F-12K (Kaighn’s) media (Gibco, Cat. #21127-022) or Human Plasma-Like Media (HPLM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fura-2-acetoxymethyl ester (Fura-2-AM) and Pluronic F-127 were purchased from Molecular Probes (Eugene, OR, USA) and dissolved in dimethylsulfoxide (DMSO) ...
-
bioRxiv - Microbiology 2020Quote: ... counter stained with 2 mg/mL Alexa Fluor® 594 F(ab’)2 goat anti-mouse IgG (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cell Biology 2020Quote: ... and TagRFP-T-VAPB(1-218)-eMagB or TagRFP-T-eMagB-PHOSBP (prey) and iRFP-P4C at a 3:2:1 ratio in OptiMEM-I (Thermo Fisher Scientific) (1:4 DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA interference was done by transfecting 100 nM siRNA (TPD54 1: GUCCUACCUGUUACGCAAU, TPD54 2:CUCACGUUUGUAGAUGAAA, TPD54 3:CAUGUUAGCCCAUCAGAAU) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY™ FL C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine (PED-A1) and BODIPY™ FL C5 were purchased from Thermofisher scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... washed 3 times with blocking buffer and incubated for 2 h with Alexa 647 anti-rabbit (1/250, A21247, Thermo Fisher Scientific). After washing the cells 3 times with PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... approximately 1 pmol injected onto a Acclaim PepMap 100 guard column (75 μm×2 cm C18, 3 μm particles, 100 Å; Thermo Scientific) and separated on a 50 cm PepMap RSLC C18 (75 μm×50 cm ...
-
bioRxiv - Microbiology 2020Quote: ... incubating with primary antibodies (rabbit anti-β-actin, 1:1000, Thermo Fisher Scientific, PA1-183; mouse anti-claudin-2, 3:500, Invitrogen, 325600 ...
-
bioRxiv - Bioengineering 2019Quote: ... medium was switched to a B27-based Retinal differentiation medium (BRDM) (DMEM/F12 (3:1) with 2% B27 (w/o vitamin A, ThermoFisher Scientific, USA), 1x NEAA and 1x AA) ...
-
bioRxiv - Microbiology 2020Quote: ... were performed on an Ultimate 3000 RSLC nano instrument coupled to either a QExactive Plus (M#1, M#3) or an HF mass spectrometer (M#2; Thermo Fisher Scientific) as described previously.24 Tryptic peptides were trapped for 4 min on an Acclaim Pep Map 100 column (2 cm × 75 μm ...
-
bioRxiv - Physiology 2023Quote: ... IALVs were then washed with PBS containing 0.1% Triton X-100 (PBST) 3 times and blocked for a minimum of 2 hr with Blockaid® (B-10710, ThermoFisher Scientific). IALVs were then stained with the corresponding primary antibodies in BlockAid® Solution ...
-
bioRxiv - Microbiology 2020Quote: ... and resuspended in 0.1 ml of PBS supplemented with the lipophilic styryl membrane dye N-(3-triethylammoniumprpyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64, Molecular Probes, Invitrogen; 10 μg.ml-1) (Pogliano et al. ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... The suspension of pellet 2+3 was filtered through 40-μm cell strainer (Fisher scientific, Cat # 22363547), followed by final wash in complete Ham’s F10 medium ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Peptides were loaded onto a C18 trap column (3 μm, 75 μm × 2 cm, Thermo Fisher Scientific) connected in-line to a C18 analytical column (2 μm ...
-
bioRxiv - Biochemistry 2022Quote: ... and after immobilization of HER2- Nb and HER2-Nb-GEPII 1.0 was assessed using 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) reagent (ThermoFisher). After immobilization of HER2-Nb and HER2-Nb-GEPII 1.0 on the cell surface ...
-
bioRxiv - Microbiology 2022Quote: ... All cells were passaged 2-3 times per week with 0.25% Trypsin/0.02% EDTA (Gibco Cat#25200056). Cells used in all experimental set-ups were between passage 5 and 30.
-
bioRxiv - Cell Biology 2022Quote: ... All the LUVs contained 2 mol% of 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DHPE)-tRed (Molecular Probes). Lipids were mixed in chloroform ...
-
bioRxiv - Cancer Biology 2021Quote: ... antagomir 2 from Exiqon (miRCURY LNA microRNA Power Inhibitor; 4100464-002) and antagomir 3 from Thermo Scientific Dharmacon (miRIDIAN hairpin inhibitor ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptides were injected into a trap column (nanoViper C18, 3 μm, 75 μm × 2 cm, Thermo Scientific) with 12 μL of solvent A (0.1% formic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA (2-3 μg) was diluted in 400 μL Opti-MEM (11058021, Thermo Fisher Scientific, USA) spiked with 2-3 μL Plus reagent (15338100 ...
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...